Pan_troglodytes Locus Mono:101:SNORA62
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:101:SNORA62
Pan_troglodytes
Mono:101:SNORA62
8
SNORA62
1001..1154
2154
ACAGCGCAGGAATGAGGAGGAGCCAGTGGCAGGTATAGAATGTTCCCACACCTCAACCA
CTGCCAGGCTCCGCAGCTCACTGACGCATCAGACACTGCTTCAGAGCACTGCTTTATTGG
TACCACTTCTGAGAAGCAGCAAAGCAGACATACGTCTTTCTTTATCATCTTCTCTGTCTC
TCAATCCCTCTCAATGACAATGACTCATTCTCTCTTTCAACCTCTCTCCCTTCCTCTCTC
CTACCCTCTACCCTCATTCCCACCCCCTTATCACTACACTAAGGCCAGCAAGAAGCCACA
ACCACAGAAGAGCTTCCAGGCAGCAGTGAAACAGTTCAGTCTCAAAGAAAGCCAGTCAGG
AGTCCAAATGCCTGTGTTCCTTCTGGAGTTCGCTATATGACCTCACTATAATCCCTTCAC
CACTGTGGGCTTATTTTCTCATCTGGAGGATGAATGGGTAAGAAGAGACTTCTGAGGTCT
TTTTCCTGCTTTAAAATTCTGTGATTTCACAATAACTGAATACAGTCACTAAACGAGAAA
CCACCAGGACACTGGGGGGCGGCCAGCACATAGCCATCTTTGTTGTATTTTTCATTGCAG
GCTTCCAAAATTTCTGTTGCCAAGAAGTATATCCAACTAGACCCTCGGCCGATGTTTTAA
TTTTTATACACCGTAATTAAAAGCAGAATGACTTGCTTTTACTTTGGATTATGTAATTTC
TTTCTATTCATAATGAGCAGCTCTTACACGATGCCAAGTGAGTTTTCTCTTAGGCAGCAC
ATTCTTACTCAACCAGAGAACTGTTGGCATTTGGATTAATAGAATCAATAATATCTTTCA
TTCCAAAACCAGAAATTGCTGTTTTGATATGGTCTGCCCACAGTTCTTCCAAGGAAAATA
TTTTTATTATTTTACTACTAATATCTCCTTACAGCTTATACATGAGTGAAGCATTTATTT
TTATATTAAATAAATCATGCTCTTTAAAATAAAAATGAATATATTCTTCTTGTTAGAGCT
CAGAGTTGAGGCCAGTGACTGGCCAATGAACTCACAAGTGTAGACAGGGTGTTACGTAAG
GGACAAGTTTTTCACTAACACCACAAGAGTCTCTGGCCCAATGAGAGGAGTTTAATAGAA
ATTCTTGCTACAACTAAAAGAAAGAAAAGAAGAAATAAAAGAATATACTCTACTACTGTA
AAATCCACTTAAGAAAAAGTAGGTTATCAGGTCTTTATTGCAGAAAGTGGTTTTTATTTC
TTCTCTGCTGTGGAAACAAACCTCCAAATCATTGAAAGGTGGAACAGTATCCTTCTACAG
AAATCAGATTTAATCTTGACAGAATTAAATAAGAATCACTCATTATACACTGATCTATGT
TTTAGCAATTATACACTGATCTATGTTTTAGCAGATATTATGGAAAACTCAAAGGTGCAA
CAGGTTCTCTGCCCTGCAAAGAGTTTACAATCTCATATGGAAATCAAATGTACACACATG
ATAAATGCTACTTAAAGACCTACTGCCTGCCAAACACTATGGAAGGCACGAGGTATGTGA
GGGAGACTCCACCTCTGCCAAAAAATTCCTCACAAGCGGGTAAGAAAGCCAGACCTGAGT
AACCCAGACAGTGCTAACCTCCCAGGACCACCTCCGCTGCACTTAGAGTGGGAAGTCCAG
TGGCTTTCCTAAGAATGTGGTGGCTTCCAGGGTAGACAGACAGGGAAGGAGATGGAGGTA
GCTTATCTTATGGTCACCTCTTGTCATTTCTCATCTCCTGGAGGTATTCCCTCTCTGTCA
AGTGAAAGTAGCACCTAGTTGGGTTGGTTGGTTGGTTCGTTGGTTGGTTGGTTGGTTGGT
TGGGTTTTATCAGTCTGACAATCTTTTATCTTTTAATTGGTACATTTAGAACATACACAT
TTAATATAATTACAAATACATTAGGGTTTACATCTACCATCTTATTTGTGCTATTCATCT
CATCTATTTTATCCTTCTCTCCTTTCTTGCCTCTTTTTTATTTAGTTTTGTTTTTATTTT
TCCCTCTCTCCCTCCACATACGCTCAAGTTTAGATGCTATACACTGCTTTTAGGCTTTCA
TTATCCTAGAAATTACAATAAATATATCCAACTGATGAAAGTGTAAAGTTAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved