Pan_troglodytes Locus Mono:133:SNORA26
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:133:SNORA26
Pan_troglodytes
Mono:133:SNORA26
4
SNORA26
1001..1122
2122
GGACACCCACAGCCAATGGCCGGGCCCGTCCCACCCCATCCGGGATTGGCTGTGCGTGC
CGCGGCCCTCCACCCCGCCCCGCTCAGGATCTTCCCGGGATTGGCTGAGCTCCCCGAACT
CTCCAGGGATCGGCTGCGCGCCCCGCCCTTGCCCAGAGTCTTCCCGGGATTGGCTGCGGG
CCCCGCGACCCTCCTGCTTCCCTCCCCGCCCCGCGCCGCCTCTCTGGTTTGTGCGCCCGT
CGCAGGTCGCAGGCCTCTTTGTCAGCTGGAGTTGCGTGGTGAGTGCATCTCCAGTCTTCG
GCTTTCGGTCTCCCGCGGGGAGGGCGCCCGGCCGGCCCGCGGGTCCGATCAGGGGCTGGG
CTCGCCCGGTGTCCCCACGAGCTTTGCCCGCCTCGAGCTCCTCTGCTCCCGGCGGCCAGA
ACGGAGGGGTAGAGCAGCTCTCGGCGGCCCGGGGGGCGGGCGGCCGTGCCCGTCCCGGGG
CTGCGCGAGGCACAGGCGCCGCGCCCAGCGAAACAGCCGGAGGTTCCCGGCGCAGGTCTG
GGCACCGTAACAATTTTGCGCTTTGCTTCCCCAGGGCTGACGCGCCACTACTTTGTAGCG
GGTTTCGGGCGGGCCACGCGTGCGGCGACAGGAACCCAACCCCAGCCGACCTTGAGCCCC
AGGAGTTCGTCTCTTACGTCTGCGGAAGTGCAGCTGCCTCAGTTCTTAGCGCAGGTATGT
TCCTAGCCTTGAGCGGGGTGGGGGGAGGAATGAGTCAGCCTGGAGCACGTGGCCAGTGGG
ACCGGAGGGTTCCCCGGCGTCTGTTTGTCGCCAAGGTCCGAATCCGGCTCCCCTTAACTG
GAAGGAAACATCCATGTAGGGGCTCACCAAACAAAACAGCTGTTTCTAGTGTGGTTTCAG
ACTTAGAGAAGCAGAGATCCACGAGGTATTGAGAGCAACGCGGAAAATAGTAGTGAACCC
TGTAAAAATCAAAGAAAAAAAATCACAAAGCACCCTTTCCTGTGCCCTTTTAAGGTTGAC
CCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTAAGTCTCCATAAAACCCAGAGAAG
AGACTGGAAAGCTCCTCTTTGGATCCTGTCTGGAGTCACAACTGAACCAGAAAAAATTTC
GTTACAACTTGAGCGCCTTTGTGATTTTCTTTACAGTTTATAGAACAAGCAATACATTTC
AGTTTTCTTTGGTTAAAACGTCATTTTAAAACTTTTCTTTCTATAGGTTGACAACTACAG
GCACAAGCCTTTGAAGCTGGAATGTCCTGTTGCTGGTATTTCAATTGACTTAAGCCAACT
ATCCCTTCAGTTACAATAGGAAAGTGCCTCTAATAAGGCCAAATATGCGTACTAACTTGC
AGCAACCACGTGTCCGTGCAGTGCCACAGGAGCTAGAGCAGTGACAATGCTGGTGGCAAC
AGGGCAGTGTAGCAGGTGCTTCATGTTCACCTTTTCAACCTTTTCATTTAATTGTCACAA
CTTGGAGGTGGATTCTGTTAGGGACAGGCTGCCCCAGGACCACTCCGCCCCCGCTAACTC
AATGCAGCTGACCCTTACCCTGAATACTCTGCAGCTGCATTCCTGAACCGTTATCTAGGC
GCTATAGCAGGGTCACCAGACTTGCTACACCGAAGCCCTCCAGGTGGCACGGGGGAGGTC
ATGAGAAACGTGGATTACACCCCCTTGTAAATTCCTATTTTCACAAGATAATATATTGTA
AGCCGGTCATGAGATTATATGTGGTAAAGTTAATTGACTAACAACCCCAGGGTCTCTCTC
CCGCATATAAACCCCTCATTTTGTAAGCTCAGGGCTGCCACCTCTGACTGGTGGAGCAGC
CTGGCAGGTTAATAAACTTACTTGGCCTGACCTTGGGTCTCTTGTCTTTTCTCTCGGCTA
ACCTTACAGATTCTATACTCCCATTTCACAGGTAAAGAAATGGATTAGGGATAACTCAAG
TTTCATCACCTGTGAGTATCTCTGAATGAGAGGCTTCACATGTATAACTTTTAGGCAATG
TGACTTCTGGAAAGTCACTTGTCTCTTGAGATTTGGTGTCCTGGTGTAACAGTTAAGAAT
TATTTCAACCAAACTAGGAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved