Pan_troglodytes Locus Mono:163:SNORA64
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:163:SNORA64
Pan_troglodytes
Mono:163:SNORA64
2a
SNORA64
1001..1133
2133
TTGGGTGGCAGTGGGTGCTGAAGAGGATGGAGGAGAGATGAAAGGTGGAACCAAACAAA
AGAAAACCATGAAAAACAGCCAGCAGGAATGATAGGATCACATGTATGTGTTTATGTAAA
AACGAATAAGGGGTGGGGAATTTAACTATGTATTGCACCTCTACTTTCTCTAGCCCTATC
TCAGGCATTGTAAAGAACAGAGGACAGCTCTGTTGGCCGGAAGCTTACACTCCCTTTGGG
AAAACAAGGCAAACCCATGCAGCACTCAGTGAGCAAGCCAACATAATTCAACATTCGAAT
TCCCTATCTCCTGAGTTCCTATCACTCTATTATATTGTTTATTTAACAAGCATTTCTTCA
GGCCACACTAGGCACCAGGTGTGATCATTGTCCCTGAGGAGTTAAAAAAGCAATATAATT
AGAGATGGATATCTAGTGCTAAGTAAATATTATCAAATGGGGTTAAAATAGCCGTAATTT
GGACAGAGAGAGGTGCTGTATGATATTTTGTCTTTATAGCCTTTGTAGTCCATCACATCA
GTATCTAGGGCTGGAGAAAGACCTTATCACCCATCTAGTGTAACTTCTATATATTAATTA
TGAGGAAACTGAGGCCCTGGGGGAGCAAATGAGAGTAGTCCCTTCCAGTGATTAGCAGAG
CTGAGCTATAGCCCACAGCTCAAGAACTAGGCTTGTTTCTGTCCACCACACAATAGTGTC
TTCAAGCAAAACTAAGAACAAATAATGTCTGACAGTGAAGGATTTGATGTTTTAATGATC
TTTCATCTGAAGCAGCAAATATAATAGGGAAAATATGGTGCTATAGGTTCAATTGTCTCC
CCCCAAAAGATGTATTCAGGTCTTACCCTCTGGAACCTATGTATGTGAGCATATTTGAAA
ATAGAGCCTTTGTGGTATCGATGACTGCTACACCTCAGCCCGGGGCTGCACTGCCACCCT
GGGCAACTTCAGTAGGTGGTCCACGCATGGGGCATAGCCATGGTCTCTCAGCTCTGCTTA
ACCACATGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAGGCAGAGAAAGGCTCTCCTA
ATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCTAGGAGTGTGACAATTTTTGGG
TAAAAAAAAAAAAAAAGAAAATAGAGCCTTTGCCTATGTAATGAAGTCAAGATGAGGTCA
TACTGGATTGGGGTGTTTCCTAAATCCAGTATGACTGGTGTCCTTATAAGAAGAGAGAAA
TGTGGACACAGAGATACAGACACACAGGGGAGAAGGCCACACCAAGATGGAGGCAGAGAT
GGAATGCTGTATCTGTCTGTAAGCCAAGGAGCTCCAAGGCCTGCCAGCAACCACCAGAAG
CTAAAATAGGCAAGGACGGATCCTTCTCTAGAGCCTTTGGAAGAACATGACCCTGTAGAC
ACCTTGATTTTAGACTTCTAGCCTCTAGAACTGTAAGATAATATATTTCTACTGTTTTAA
GCCATGCTAATATACATGGCTTGGAGTTTGTTAGATCTAGGTAAAATCTTGTTTTTGTTA
TTTACAAGACGGATGATCTTGGACAAACCAACAAACTTCTTTGATCCTTGGCTTCATTAC
TGTAAAACAGGGATAATAGCAGCACCTCGGTTGCTGTGAGGATAAAACAAGGTAACTCAT
GGACAGCACCCAGCTCCTAACCACTCTACTGAACTCTGGGAAAGGAAATGGACCAGGCTG
GGCTCAGGGAAGGTAGCAGGCTCTGAGTCCCTCTTCCCCAGAACCTCATGATGCCATGTG
GAGCAAGGCTGGCCAATTCATCTTTTTGGCTGGAATTAACCTACAGTAATGGCTTGCATG
CTGTAGAATAGCTATGCTGTTGGCTGAAGCCTATCCCTCCCTGACATTAGTAACAACTTA
ATGGTCTAGAGAGTGATGCTGAGGCAGGAGAATGGGGTCTGGAGGGAGGGAACATAAAGC
CAATTCACACTGACTTCCTAGAACTAAATCAAATAGAAACACTTCAGCTATGACAGGAAA
TACCCTCTCCATTTACATAGGGCGTACACCAACTAAATGACTTTGTAACTTTACTACATT
CTCCTCATTTACATAGAGTGTACACCAGTGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved