Pan_troglodytes Locus Mono:145:SNORA67
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:145:SNORA67
Pan_troglodytes
Mono:145:SNORA67
9
SNORA67
1001..1137
2137
CAGTTTCAGGATACAAAGTCAATGTACAAAAATCACTAGCATTCCTCTATACCAGTGAT
AGCCTACAAAAATCACTAGCGTTCCTCTATACCAGCGATAGCCAAGCCAAGAGCCAAATC
AGGAAGGCAATCCCATTCACAATCGCCACAAAAAGAATAAAATACTTAGGAATACAGCTA
ACCTGGGAGGTAAAAGATCTCTACAATGAGAATTACAAAACACTGCTCCAAGAAATCAGA
GAAGACACAAACAAATGGGAAAACATCCTATGTTCCTGGATAGGAAATAAATATCATTAA
AATGGTCATACTGCCCAAAGCAATTTACAGATTCAATGCTATTCCTATCAAACTACCAAT
GACAGTATTCACAGAACTAGAAAAAAAACTACTTTAAAATTCATATGGAAGGAAAAAAGA
GCCTGAACAGCCAAGGAAATCCTAAGCAAAAAGAGCAAAGCTGGAGACATCATATTACCC
AACTTCAAAGTATACTACAGGGCTACACTAACCAAAACAGCATGGTACCAGTACAAAATC
AGGCACATAGACCAATGGAGCAGAATAGAGAGCCCAGAAATAAGGCTGTACACTTAGGAC
CATCTGATCTTTGACAAAGCTGACAAAAACAAGCAATGGGGAAAAGACTCCCTGTTCAAT
AAATGGTGCTTGGATAACTGGGTAGCCATATGCAGAAGATTGAAACTGGACCCCTTCCTT
ACACCATATACAAAAATCAAATCAAGATGGAATAACCACTTAAATGTAAAACCCAAAACT
ATACAAACCCTGGAAGACAATCCAGGCAATACCATCCTGGACATAGGAATGGGCAAATAT
TTCATGGCAAAGACACCAAAAGCAATCGCCACAAAAGCAAAAATTGGCAAGTAGGATCTA
ATTAAGCTTAAGAGCTTCTGCACAACAAAAGAAACTATCAACAGAGTAAACAGGCAACCC
ACAGAATGGGAAAAACTATTTGCAAACTATGTATCTGACAAAGGTCTGATATCCAACATC
TATAAGGAACTTAAACAAATTTACAAGAGAAAAGCAACCCCATTAAAAAGTGGGCAAAGT
AAGGTCTTTGGGGAACAGGGATGCTTATTTCCTCTGCCTTCCTTGTCTGCCTACACGGAT
ACCTACGTCTCTTCCCTTTGGGATACATCTCACGCACATGCTGAAGAGTTGTCTTTCTTG
ACATAGGCCAGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCAACCATGACCTTCCCACC
AACAGGGAAAACTATATCCACAGAATCAGTCGAGGTGGATGGTTTGGCCGTAAGGGTGTG
GCTATTAACATGGTGACAGAAGAAGACAAGGGGACTTTTCAAAACATCAAGAACTTCTAC
AACACTTCCATTGAGGAAATTCCCCTCAATGTTCCTGACCTCATCTGAGGGGCTGTCCTG
CTCCCTAGCCCCAGCCAGGGTTCGATCTTGGAGGGCTGAGGAGCAGCAGGAGAGGGGAAG
GAAAGGAGCCAAGGGATGGACGTCTTGTCATTTTTTTTCTTTGAATAAATATCATTTTTT
GAGGCAAAAGAAAAAAAAGTAGGCAAAGGACATAACAGACACTTTCCAAAAGAAGACATA
CATGCAGCGAACAAGCATATGAAAAAAAGACTCAGTATCACTGATCATTAGAAAAATGCA
AGTCAAAACCACTGTGAGATACCATCTCACACCAATCAGAATGTCTGTGATTAAAAAGTC
AAAAAATAACAGATGCTGGTGAGGTTGTGGAGAAAAGGGAATCTTTATACACTGTTGGTG
TTAATTAGTTCAACCCTTGTGGAAAACAGTGTGGCAATTCCTCAAAGAGCTAAAAACAGA
ACTACCATTCAACCCAGCCATCCTACTACTGGATATATACCCAAAGGAATATAAGTCATT
CTACCATAAAGACATGTGCCTGCAAACGTTCATTTCAGCACTCTTCACAATAGCAAAGAC
ATGGAACCAACTCGAATGCTTATCAATGACAAATTGGATCAAGAAAATGTGGTACCTGGT
CGGGCATGGTGGCTCACACCTGTAATCCCAGCACTTTAGGAGGCTGAGGCGGGCAGATCA
CTTGAGGCCAGGAGTTCGAGACTAGCCTGACCAACATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved