Pan_troglodytes Locus Mono:129:SNORD75
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:129:SNORD75
Pan_troglodytes
Mono:129:SNORD75
4
SNORD75
1001..1058
2058
TGACAGCATGAGAATGTGCTGCTACTTTTAACCCTCCAGATTGGGTTTCTCCCCAACAC
AAGTGACCAAGCAATTTTTTCTGAAGAGTCTTGAATGATATCCACATGACCAGTTTCTCC
ATTTTACATGATAATGTAAATTAGTACTAAGGGGATGTCTTTGGTTAATTACTGCAAACA
TTTGAGTCTGCAAACTCACCCCTTACAAACTATATGACACTGAATACTAGATTAAATGTG
AATAAGGCAAAAGATGAATGTTTCCTCTACTATCCTAATGCAGGCCAGTCTCCAGGCATA
CTTTTTTTGGGGGGGAGAAGGGGGTACAAAAAAAAAAGACAGCCATTGGGAAATTCATAG
GGTAAGTTAGGGAGGTGAGAGGATACTGAAGGTTTTTGCAACTACCCATTTTTGGAGGGT
GGAGCAGTTTTTTGGTTCATCTTTGCACAGAGTCTTCAATAAAAGTTTATTAAATTAATT
AAAAGACAAATATGACAGCCCTTCAAATACTTAATATTGTTATATGGGAGAGGCATTAAT
AAGTCTTTCTGTAATAGCCACTTTTTGTTCTTACTTTTATTCCCTTAAAGTCACACAGAA
TAATAAATGGGAGAGTTTCTAAATTATTGGAATTGTTTAAAAATTGACCACGTAGAGACT
TTTTTGCTGTTACTTCTGGACAACCACAGAAGAAAATATGCTTTCTGTTGATGATCAAGC
TAGACGACCACTAATTAGCCTCCCAACTCTGCCGTTTAGAATTATAGGATCTTCAGTTTT
CATTTTCATTCAGATACTTATATTCGTATTCATTAATCAAAAATGTCTTCAAAGTTTCAA
AGAGTTCAATTATAACTGAAGGAATTTGGAGACAGACCTGTCTCCAGGGCTGTTTTAGTA
AATTAAGGTATACCTGTATGTTGGAAAACCTAAGCAGGCATAATATGTGTTTATGGACAA
AGAAAAATGGTCATAATATAGCATTAAGGAAAAAAAAGTTAGGCCAGTGATGGTTTAAAA
GTAATGGACAGAAGGTTTCTGAAATTCTATTTTGAAGCTTTAATGTTTAAAAAATGTTTT
TATCAAGTATGTGTATGATATATATAAATAAACTAGGGCTAGAAGAAATGTAACTTCTAA
GTTTCTTATCTGGACCAATTTACTTATTTGGCATAACTGAACAACAGCTCAACTCTTAAC
ATAATTGAGCCTCTTTTATTCTGCAGAAAGTTTGATTCCATTACCCTCTCACCTTGAAAG
AAGGGAAATAGTTTGATAGTGAAGGAAAGGGAGGAGTCTACCCTTGTCCTTTGTTTCCCT
CATCATACACTTAGTCTTTAAACTCTCTTTACCTGGAGAGACGCATTTTAGTGGAGTAAT
GAATCCAGAAACCAGAGATGGACTGTCTATTCCCAGATATCAAATTAATGATCTTGGTCC
TTTTTTTCCTCTACCTTTCTATAATGCTCAGCCATGATAAGCATCCATTTCTTTTGAAAA
GTCTCTGTTCTCTTGGCTTCTGTGAAACTTCAGAAGATTTGAAGATAATGTAGGAAAAAT
AATTTATATCTTGTTCATTTTCTCTGTCCACTGGTCTTGAATTATTTCAAGCATCAGCCC
TACTTGCTTTCTTTCCTTTTCATTTTTTCCATCCATTATTCCTATTTAGATGACTCCCTA
ATGTCCATCTCCACTCCTAATCTCTTTTAGTTCTCTATTTCTAACTGCCTCTTGGGAAAT
TCTTGGGCACACCTAATTTTACTATCTTTGAAACTAAATGAATCGTTCATCATTAGTCTT
GTTCCTCCTCTTGTGTTTCTTAGGTGGGGTGAGTAAAAGATTCCAATCAAGACTAGTTTA
AAGTTTGAGGAGCCATGGAAAGAAAGATCAGTCAAGACCACTAGGACTTGAGAACTCCTA
TCTTTCTCCTCTCCATTTTATTCAGTACAGACCCATTATTACTAATTTAAGTTGCACAAA
AGGCTATCAACAGTCTATTTACTGTGCTCTTTTATAGTTTTATTAATTTTATGGAACTGA
CATAAGTTCACCACTAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved