Pan_troglodytes Locus Mono:105:SNORD65
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:105:SNORD65
Pan_troglodytes
Mono:105:SNORD65
8
SNORD65
1006..1073
2073
TGCCTCAGCCCCACCAAGTAGCTGGGATTACAGGCGCCCGCCACCACGCCCAGCTTATT
TTTGTATTTTTAGTAGAGACGGGGTCTCGCCATGTTGGTCAGGCTTGTCTCGAAATTCTG
ACCTCAGATGATCACCCGCCTCTGCCTCCGAAAGTGCTTTGATTACAGGCGTAAATTACC
ACGCCCAGCCTTCAGGTAGTTCTTTATAGCAGTGTGAGAATGGGCTAATACACCCCTTCA
AAAACATGTAAAACATACACCTATGCTGTGACTCAACAATGAGAAATAAAAACATGTTTA
TGCAAACACTTATATAAGAATGCTTATAGCAGCTTTGTTCTTAATAGTCAAATCCTGAGT
ATTAATAGGAGGCTGGAATAAACAAACCGTGGTTTATAAAATTACCTTCATTAAAAAAGA
ATGAGCTACTGATACATGAAGCAGCATGGATGTCTCTCAAAACTCTTATGCTAACTGAAA
GGAACCTCGCACACAAGCGTGCATGCTGTACAACTCCACCTATGAGAAATTCTACAACAG
GCAAATCTAATCTATGACGGAAAAAATCAGAATAGTCGTTATGTCTGAAAGGGTAAAGTT
AAGAATTGACTTGGGACAGCCAGGTGCAGTGGTGTGCACCAGAGTCCCAGCTACTTGGGA
GGCTGAGGTGGGAGGATTGCATGAGCCCAGAAGTTTGAGGCTGCAGTGTGCTGTGATCAC
ACCACTACATTCCAGCTTGGGCAACAGAGCGAGACCCTGTCTCTGAAAAACAAACAAACA
AACAAACAAATAATTGACTAGGGAGAGCATAAAGAAAATTTCTGAAGTGACGGTGATGTT
TTATCAGTTGATATGGGTTTGCATTACATAAAAGAATGCATTTTTCAAAATGTACACTTA
AGATTTGAACATTTCATTGTATCTGAAGTTTACATTAAATGAAATATATATATATACACA
CACATACACATATATACGTTTGTGTGTGTGTGTTTGTGTGTGTGTGATGAAATCACCCCA
AATAGCTGGAATTACCAGCAGATTGTATAGTGGTGAACCTACAATTTTCTGAAGAAAAAG
AAATATACTCAAAAATAAATATTGAACTCAATAATACGCATGTTTACATATGCACTGATG
TCTTATTTTACTTTGAAATGGATGGATAATGGAAAAATGCATATTGAAACACATGTAGCA
AACTGCTTATGGTGAAATCTTGGCAGTGGGTTTATGAGTTTTCATTGTAAAATTCTTTAA
CTTTTCTACATACTTAGAATTTTTCATAAGATATTGAGAAAAACCTTGAAAAACAAAAAT
ACAAGAAAATGGGACTTTGAGGTAATAGAAATTTTCTTAAGACAAAAATGCACAGAAGAT
ACATTTTACCACATTAACACAAAGAAACATTGGTCAGCAAAAGACATCGTGAAGAAAGGG
AAGAGTGAAAATAAGCACCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGGCAGATCAC
CTGTGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGCGAAACACTGTCTCTACTAAAA
ATACAAAAATTAGCCAGGCGTGGTGGCACACACCTGTAATCCCAGCTTTCAGGAGGCTGA
GGCAGGAGAATCGCTGAAACCCGGGAAGCAGAGGTTGAAGTGAGCCAACATCACACCACT
GCACTCCAGCCTGGGTGACAGAGCAAGACTCCGTCTCTAAATAAATAAATAAATAAATAA
ATAAATAAATAAATAAATCTGAATGATCCATGTGGGTCCAATGATACCATCACATGTCCT
TATAAGAGGGAGTCAAGGGAAACAGAACTACCGAAGTGGAGACGGTGCTGCGATGTTGCC
AGCAGGTGCTGGATGATCACTGTCAAGGACTCCAGGCAGCATTAACAGCTGAAGGGAACC
GACGGTCCCCTCAGAGCATCCAAAAGGGGTCATTCCTGCCAACATCTTGCCCTTCACACA
GGAAAACTGCTGTCCCAACTTCTGACTCCCAGAGCTTAAGGGAATACATTTGCATTGCTT
TCAGCCACGAAGTTTGTGGCGATTTGTCACAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_006475
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved