Pan_troglodytes Locus Poly:9:SNORD14
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:9:SNORD14
Pan_troglodytes
Poly:9:SNORD14
8
SNORD14, SNORD14
1001..1112, 5812..5923
6923
AATCACTTCCTTCAATCAGATTTTTATACACGTTTGTTTGAGGTCGAGCTAGGCCTTTC
AGTATTACATAAAATCCATCATTTGCAACCACTGAAAAAGACAAAGCCAAAAAATATATA
CTGTGTGCTCAGGCTCCTTGATATAGATATGACTAATATATATATTACACTTATGGTACT
TTCAACGTATTTCTTTCAGTGTATTCTGTAACAGTGAATTTAATGTAATAGGCATTTTCA
AATAGTTTACTCAAGTAACAAGAATAACAAAGGCATGTTTATACATTTGGAGTATTCTTT
TCAGACAATTACATATAGTAGCTATCCTCTCACAGAACTGATGGGTTCTAGTGGAAGAAA
ACATGGTTACATATAATTATTAATAGATTTGAGACATTGTGAGAAAAATGGGACCAGAAA
AGCCCTTGAATGTTTTTTTAATGTTTATGACCCTCCCATACACAAAATGCCATTTTTCCT
ATTTTATATAAATAACAATATATATCTACCCTTAATTTTCATTTATCTTTGCTCTGGACA
TGATGACAATTACTTATAGAACTTAATAATGGAGACAGTTTGGAGAGGGTGGCTGATTAT
TACTAGAAAGAAGAGTTTTTCCCATATCTGTCCTACTCCATAACATAAATCCCTAAAAAC
TGTCATCCAATCCCAATTCCTAACGTTAAACTGTGTGCCTGTAGGTCCGAAAGACATACT
CATTTTTTAAATATTTCTAATGCAACTTAAATTAATTCCAGTTCTTCTGAAGCTTTTGAA
GAATAAGGGAGTAAGAATGGGACGGTGTCTTTCTCCATTTCTTATTTACATTACTTCAAA
AGATTGAAGCAAATTACTCAAGTGCTGTCAGGAGATATTTTCTTACACTTTGCTTATGAA
CTTGAAAGAAATAGAAACTTTACAAATTGCATTTTCAGAGAATATCATTTTTTTAAATGT
CCGAAAAGTCATCAAATGCTTGCCATGTCTGCTTTTTTTGTGAGTGCTTATTAGTGTGAC
TTTCTTAGTCACAATTCATACACAGTGACCACGGGAGAGTGATTTTCATGCTTCTTTAAA
GCAAAGGTTGTTCTTGCTTGGATGTCTGAGCTTAAACTAGACCTCCTTCCAGGCAACACA
ATACAAGGATATCTTGTTTTACTGTGCTTTGCTTTTCAGTGCTTCACAGATATGGCATTT
TTTACACATCAAAGATTTGTGCAACTTTGCATCTAGCAAGTCTATCAGCACCATTTTTCC
AATAGCATGTGCTCACTTTGTGTTTCTGTGTCACATTTTGGTAATTCTCACAATATTTCA
AACTTTTTCATTATTATTTTATCTGTTGTGGTGATCTGTGATCAGTGATCATTGATGCTA
CCATTGATGTAATTGTTTTGGGTACCACAAACTATGCACATATAAGATAATGAACTTAAT
TGGTAAATGTGTGTGTTTGGACTGCCCTATTTAATGGCTGTTTCCCCATCTCTCTCCCAG
TCGTCAGGCCTTTCTACTCCCTGAAACACAGCAATGTTAAAATTAAGCCAATTAATAGCT
CTAAAATGTCCTCTAAATGTTCAAGTCAAAGGAAGAGTCATGTGTCTCTTACTTTGAATC
AACAGCTAGAAGTGATTAACCTCAGTAAGGAAGGCTTGTTGAAAGATGAGATATGCTGAA
TACTAGGCCTTTTACACCAAATTATAAGCCAAGCTGTGAATGCAAAGGAACAGTTCTTGC
AGAAATTTAAAAGTGCTATGCCAGTGAACACACTAAGGAAGAAAAACAGCCTCATTGCTA
TACTGAGAAAGTTTTAGTGGTCTGGATAGATGAAACCAACCACAACATTCTCTTAAACCA
AACCTAATCCAGAGCAAGGCTCTATTTCCATTCAATTTTCATGAAAGCTAAGAGAGGGTG
AGGAAGCTCCAGACGAAAAGCTGAGAGCTAGCAGAGTTTGGTTCATGAGGTTTAAAGATA
AAAGCCATATCTATAACATAGAAGTGCAAGGTGAAACAGCAAGTGCTGATGTAGAAGTTG
CATCAAGTTATCCGGAAGACGAGCTGAGGTCATTGATAAAGGTGGTTACACTAAACAGAT
TTTCAATGTAGATGAAACAGCATTCCATTGTAAGAAGACGCCATCTAGTACTTTTATAGC
TAAAAGAGAGAAGAAGTCAATTCCTGGCTTCAAAGTTTCAAAGGAGAGGTTGATGATGAC
ATACAGCTGGTGATGGTGACATGCAGGTCAGCTGACTGTGACATGCAGCTGGTGACATTA
AGTTGAAGCCACTACTCCTTTACCATTCCAAAAATTCTAGGGCCCTTAACAATTATGCTA
AATATACTCTGCCTGTGCTCTATAAATGGAACAACCAAGCCTAGATGACAGCATATATTT
TATAGCATTCTATAATGAATATTTGAAGCCCACTGTTGAGATCAACTACTCAGAAAAAGA
CTCCTTTCAAAATACTACTGCTCATTGACAATGCATCTGGTCACCCAAGAACTCTGATGG
AATTATGTAAGTAGATGAATATTGTTTTCCTGCCTGCTAACACAACATTCATTCTGCAAC
CTATCAATCAAGAGGCAATTTCAACTTTTAAGTTTTATTATTTAAGAAATACATTTCATA
AGTCTATAGCTACCATAGACATAATTATTCTGATGGATATGGGCAAAGTAAACTGAAAAC
CTTCTGGAAAAGATTCATTATTCTACATGCCATTAAGAACATTTGTGATTCGTGAGAGGA
GGTCAAAATATCAACACTAACAGGAGTTTGGAAAAGTTGATTCCAACCCTCAAGGATGAC
TTTGAGGGGTTCAAGGCTTTGGTGGAGGAGGAAACTGCAGATGTGGTGGAAACAGCAAGA
TAACTAGAATTAAAAGTGGAGCTTACTTACAGATGTGACTGAATTGCTGCAATCTCATGG
TAAAACTTAAACCAAATAAGGAGTTGCTTCTTATGGATGAACAAAGAAAGCAGTTTCTTT
AGATGAAATCTACTTCTGATGAGTAGGTTGTGAACACTGAATTTTAAAAAAGATTTCGAA
TGTAACATAAACTTAGTTGATAAAGCAGTTGGCAGGGTTTGAGAGAAGTGACTCAAATTT
TGAAATGTTTTGTGGGTAAAATGTTATCAAACAGCATTACATGCTACAGATAAGTCTTTT
GTAAAAAGAAGAGTCAATTGATGCAGAAAACTTCATTGCCATCTTCTTAAGAAATTGCCA
CAGCCAAACTGGGCATGGTGTTGTGTGCCTGAAGTCCCAGCTACTTGGGAGACTGAGGTG
GGAGAATCACTTGAGCCCAGGAGTTCAAGTTCAGCCTTGGCAAAAACAACAAGACTCTAT
CTTTAAAAGGAGAGGGAGAGAGAGAGAGAGAAACAGAGAGAGAGAGAATTTGCTGCAACC
ACCCATATCTTCAGCAACCTCCACCTGAATAGCCAGCAGCCATCAACATTGAGGCAAGAC
CCTCCATTAGAAAAAGATTAGGATTCACTGAAGGTTCAGATAGTCATTAGTATTTTTTAG
CAATTAAGTATTTTAAATTAAGGTATATATATTTTTAAACATAATGCAATCACATGCTTA
ATAGACTACAGGATAATGCAAACAACTTTTATATGCACTGGGAAACCAAAAAATGTGTGT
GACTCACGTTATCGTGATATTCATTTTGTTGCAGTGCTCTGAAACTAAACCTAAAATTTC
TCTGAGGAATGCCTGTATAATAGATGGATCAAATGCTAGTCTAGGAGACAAGAGAAGGAC
TGATTTTTAGTCCCAGTGTTACATTCATTGTGTAATTATGGGAAAATCATATATTCCTAG
GATCAACGTCCAGATCAAAGATTGTCATGCTAAGTTATCTACATGTATTTTAAACGTATT
ATTTTGTCAATTATTCATTGAATATAATAATTTTATGTTGTTGTAGTTACTATTAAAGGG
CTTAAATGAATTTTAAAACTAATATACATAACCAAATTTTACCAATGCAAAGATTATCTT
AAAAGTTTTGGCCAATTTAAATTTGTGAAATTTTAAACATGTAGATGAAAAAGACTGTAT
CTAATAATAATAATTAAATTAGTTAACAATAATGTTAAAAACCTCATATTACATACTATT
ACTTCGGAAAAACTGTGTTTAATTTAAAAAGCACAAATATTCAAATATCTCACATGACTC
TTCTCTTTTAGTTTCTTCATCATAGTTCAGATTATTTCTTTCATCATCCAACACATTTCC
CTGAAACCATTATCTTTACTCAAGTTGGTTTGGGATACAGTATATTTGCATTTTAATGTA
AAGAAGTCCCTGAAATTATATCGCAAGCTACAAGTACTGTAATCATTTACACAACATTGA
CAAGTATTTATATAATGTTTTTTAGCTAAATTTATTTTTTAATTTTGTAAAATGCTGAAT
TTATTGCTAACAATGCTTTTACAAAATTAAACTTACTGAAAAGGCACAAGAAAAAATAAG
AATCACCCATACTTATACAAATCAGAATTTTTGAATAAGTGCATTTATTTGGAAACAGAA
GAGGGAGACTGCAATAGCCAAAAGTTTAAAAACTGAAAGAATCAAATATTGGCATAGATG
TGAAACATCTAGAATTCTCACACATTGTTACTGGGAGTATAAATTATACAATTAGTCTGT
AAAAATGTCTGGCAGTTTTTTATAAAATGAAACATATGTCTAACCTATGTCCCAGTAATT
CATTCTTAGGTATTTGCTCAGGAGGAATGAAAGTAGATGTCCAAAAAGGACTTGTACAAG
GATGTTACTAGCAGCTTTATCATAATAGCTGAACTCTATAAAAATCTCAGGTGTCCCTCG
GAAGAAAATGTGTAAAGAAGCTCTNNNNNNNNNNTTGCAACCACTGAAAAAGACAAAGCC
AAAAAATATATACTGTGTGCTCAGGCTCCTTGATATAGATATGACTAATATATATATTAC
ACTTATGGTACTTTCAACGTATTTCTTTCAGTGTATTCTGTAACAGTGAATTTAATGTAA
TAGGCATTTTCAAATAGTTTACTCAAGTAACAAGAATAACAAAGGCATGTTTATACATTT
GGAGTATTCTTTTCAGACAATTACATATAGTAGCTATCCTCTCACAGAACTGATGGGTTC
TAGTGGAAGAAAACATGGTTACATATAATTATTAATAGATTTGAGACATTGTGAGAAAAA
TGGGACCAGAAAAGCCCTTGAATGTTTTTTTAATGTTTGTGACCCTCCCATACACAAAAT
GCCATTTTTCCTATTTTATATAAATAACAATATATATCTACCCTTAATTTTCATTTATCT
TTGCTCTGGACATGATGACAATTACTTATAGAACTTAATAATGGAGACAGTTTGGAGAGG
GTGGCTGATTATTACTAGAAAGAAGAGTTTTTCCCATATCTGTCCTACTCCATAACATAA
ATCCCTAAAAACTGTCATCCAATCCCAATTCCTAACGTTAAACTGTGTGCCTGTAGGTCC
GAAAGACATACTCATTTTTTAATATTTCTAATGCAACTTAAATTAATTCCAGTTCTTCTG
AAGCTTTTGAAGAATAAGGGAGTAAGAATGGGATGGTGTCTTTCTCCATTTCTTATTTAC
ATTACTTCATAAGATTGAAGCAAATTACTCAAGTGCTGTCAGGAGATATTTTCTTACACT
TTGCTTATGAACTTGAAAGAAATAGAAACTTTACAAATTGCATTTTCAGAGAATATCATT
TTTTTAAATGTCCGAAAAGTCATCAAATGCTTGCCATGTCTGCTTTTTTTCTGAGTGCTT
ATTAGTGTGACTTTCTTAGTCACAATTCATACACAGTGACCACGGGAGAGTGATTTTCAT
GCTTCTTTAAAGCAAAGGTTGTTCTTGCTTGGATGTCTGAGCTTAAACTAGACCTCCTTC
CAGGCAACACAATACAAGGATATCTTGTTTTACTGTGCTTTGCTTTTCAGTGCTTCACAG
ATATGGCATTTTTTACACATCAAAGATTTGTGCAACTTTGCATCTAGCAAGTCTATCAGC
ACCATTTTTCCAATAGCATGTGCTCACTTTGTGTTTCTGTGTCACATTTTGGTAATTCTC
ACAATATTTCAAACTTTTTCATTATTATTTTATCTGTTGTGGTGATCTGTGATCAGTGAT
CATTGATGCTACCATTGATGTAATTGTTTTGGGTACCACAAACTATGCACATATAAGATA
ATGACTTAATTGGTAAATGTGTTTGGACTGCCCTATTTAATGGCTGTTTCCCCATCTCTC
TCCCAGTCCTCAGGCCTTTCTACTCCCTGAAACACAGCAATGTTAAAATTAAGCCAATTA
ATAGCTCTAAAATGTCCTCTAAATGTTCAAGTCAAAGGAAGAGTCATGTGTCTCTTACTT
TGAATCAACAGCTAGAAGTGATTAACCTCAGTAAGGAAGGCTTGTTGAAAGATGAAATAT
GCTGAATACTAGGCCTTTTACACCAAATAATAAGCCAAGCTGTGAATGCAAAGGAACAGT
TCTTGTAGAAATTTAAAAGTGCTATGCCAGTGAACACACTAAGGAAGAAAAACAGCCTCA
TTGCTATACTGAGAAAGTTTTAGTGGTCTGGATAGATGAAACCAACCATAACATTCTCTT
AAACCAAACCTAATCCAGAGCAAGGCTCTATTTCCATTCAATTTTCATGAAAGCTAAGAG
AGGGTGAGGAAGCTCCAGACGAAAAGCTGAGAGCTAGCAGAGTTTGGTTCATGAGGTTTA
AAGATAAAAGCCATATCTATAACATAGAAGTGCAAGGTGAAACAGCAAGTGCTGATGTAG
AAGTTGCATCAAGTTATCTGGAAGATGAGCTGAGGTCATTGATAAAGGTGGTTACACTAA
ACAGATTTTCAATGTAGATGAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved