Pan_troglodytes Locus Mono:309:SNORD44
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:309:SNORD44
Pan_troglodytes
Mono:309:SNORD44
13
SNORD44
1001..1061
2061
TCTCTCCATCACCCCTTGAGCCAGGGAATCCATGTGAGTGGGTCTGCCAAGAAGACCAA
GTGAAAAAAATGAGAGTCTTCCAGTGATGTTTTGAGTGCCAGGTCCAGGTGCTTTTACAT
TCATGACATCGTTCAGTTGTCACAACAATCCTACCATGTAGGATTTAATATCTCCACTTT
ATGGATTAGAAAATTGAGGATTAGAGAAGTCACCAACCAGTGCTCCAGGCAACTGCAGCT
CACGAAGCTGTGACTTGCCTCCAAAGACTGCTGACTAAAGGCTGGAAAGTCTGGCTAAAC
CTACTCGTGTGCATATCACCTATGAATTAGCATAGTCAATAAATACTAGAAATGTTACAG
TTGTTTTAACTTTTCAAATGAAATTTGTTTTTCTTGTGAATTAATTAATGACTGAGAAGC
CCCTTTCTTCCTATATAACATGGGTTATTTTTATTTTTATAGCATCTAATATTATTATAA
TATTATACACACACGTATCAGCAGACTCTTCCTCTTTTGAATGACAATTACTCAAACTCA
CCCCATTGACAATATCTAACTCTTCGGTGAAGTCTTTCAATAATTGCAGCTGTGCTTCTA
TATTCAAGGACTGGAATAAAGTGAAATATTGACCCTGGTCAGCTCCGATTCAGAGAAGAT
TTTGATATACCAATTGTATTCCTATTCAACAATTTGTACATTCCATTCTAATTGCATCTG
GCTTACTACAGAGGTTGAGTGTGAGAAAAAAGATGGGGGCAGGAGAAGATGAGAGGGAAG
CTTGTGTTCAGTTAAACATAAGTACAGAAATTCAACAAACCTGTGAAATTCATTATTTTA
TGGCTCATCAGTTGGTTCAGCTTAAGTCCTTGGATAAACTGCATAGAAAAATATTACCGC
TTTAGTGAAATTACTGCTTCTAATAAAGAATGGGTAAGCAGAATCTCAAGTTATATAATT
TTTTTTGATGAAGTCAATTCCAACAACGTGAAAGCCACTGCCCTGGGTGATGATAAGCAA
ATGATGCCTGAATGTGAAGGTCATACTCGGCTTTAGCTGATTTCAAACAAATAAACAAAA
ACCCTCCACCACAAATGATGATTTCGGAAAGTTATCTCGCCCCTGGAATCACCTGTGATG
ACAGCATGATCCTTCTAGCTGCATCCTCTTTATCCTTCAAGCTCCCCCACCATGAGGCCC
GACCCTCCCGGGGTTGCACAGCTGCACTCCACAATTCCACACGGAAATCTCGGGGTTCCT
CCGCCACGTCCGCACAGCACATCTGCCCTGAGCAATTGTTCCCCGCCCCTCCCTCAAAAG
ACCTAGGCCCAGTTCCACCTCACAGCTGCCCTGAGCAATTGTTCCCCGCCCCTCCCTCAA
AAGACCTAGGCCCAGTTCCACCTCACAGCTGAAATTAGACATCCAGTGCACTGCACGCGC
CCGGGCAGGGATGCTTGCTGGAGTTGATATCTGTTCCAGTCAACCCTCACCTTCCTGAAC
GGCACATGCACCTCGGTAGGAGACGAAGCAAAATTCTGTGGTTAGATACTTTTACGTGGG
AAAATAGTGAACTTTAGCCGGAAGGTGAAAATACATTCTTTTCTGTACATTTAGAATTAA
TGAATCCTATAGATCTGTGGAAACTGCTTTTAAACATCTGATTTTCCATTAAAATATAAT
TAAAATTAATGGCACAGAGAAGCTTTAGTTCTCTGGTGCGCCCCCCCCCCCCCCTCGGCA
GGAGAATATTTGTTCTGTATATTTTTAAGAGGGTTTGGGGGGCATTAAATTATGCTTTGA
TTGTATTCCATCAATGAGAATATAAGACACAAACATTATTATAAGAAACAAATAAGCACT
TATTAACTGTGTGTGCATTCATGGGACACAGAAATGGTCTCAGGCTGAGCTTATAGTGAA
GCAAATTAAAATTAGTGTTTTGACTTTTGTTCATTATAAAGTAGATACTAGCCTAAAGAT
TCCTAATCAGTTGCCAAATACCTATCGTGAAGGAATATGCAATGCCGAATGAAATCGCTG
TCCTCAAGAGAAAGCTGTGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved