Pan_troglodytes Locus Mono:243:SNORD60
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:243:SNORD60
Pan_troglodytes
Mono:243:SNORD60
16
SNORD60
1001..1083
2083
CCCCACCGCGCGGTCCCGAGGCGCGAGCCCCGGGTCGGGCGCGCCGCGGGGACACTCAC
CCGCCCGCGGCCGCCCGGGAGCGGCAGCGCCGCCAGCCCGCTTCATGATGCCCCCTCGGC
CGCCGGCCGGGAAAGGGACTAGACGCGCGAGCCGGAAGCGCCAGGCCGCTGCGCCCGCCG
GGACGTGTAGTTCCCCGCCTCTCCGGGCCCGGACGGCTGCCTCACGCGCGGCACTTCCGA
AACTACGACTTCCGGCGGCCTCGTCGTCGCGGGGCGGGATTGGCAGCTTCAGAATCACTC
TATGTTGCAGATCGAAGTCTGATTGGCTTTGTTCATCAGTCACTCACCGTTAGGCTTCAC
GGACTCGCATAAGGGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGGGAAGGAGCTTCGGGTCTGGGTCCTGAGAGACCGTCTCCA
GAAGAAATGCCACGGTACGATTAGTGGAAACAACGCGGCAGGGAGCGGAGCGTACCAGCG
GCAAGGTAAGGCGGGCACTTCCGCCAGGATAGCCCAATGACAGAGGTGGGACAGTTTCTA
TAAAAGCTTGAGCCTCGCCCGCCCCTGTCTTTTCGGAGTCGAGTCCGAAGCGGAAGAGGT
TTGTTAATATGTTTGCCATGTGCTACGCTCTTGGGACGAACTGAGCCACGAGCGTGGCTT
TGAGGGCCGTCCGAACGCTGCAGGCCGGCCAGGTCCCTGGGCGTCCAGGCCTGGCCTACG
CTCCACTTTGTCCCTTAGCGTTTAAAGGTTTCTTCCCGAATCTCAGGCCCTCAGCTACCT
GCAGGTAAGACTGGGCCGGGCTTGGGTTCCCTTATTCTCCCAGTCTGTGATGAATTGCTT
TGACTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCTGATTATTTAGCAAGACTGAG
GCTTGAGGGTGCGCACTCCTGACGGGGAGCTGAGAGTGGAAATAGGTGTTGCCCGAAACG
AAGGAGTGGGGACTTAATGTCTACATTTTGGCGCTGACTTTCAGGTTTCGTCGCGAGCCG
GCTGCAAGTTTTGAACCTAAGTAAACCTCAATCCGGAGGGCCTAGCGGTAAGGTGGGCGC
TGTGTCTATTGAAGTGCTTAGCAATAAAGCAAAGGTAGTGAGTTGATTCGGTTTTCTCTC
AAGTGTCTTTATTTTCCTATTCTGGCACCCCAGAGGTCTGGCTGATCCACAGGCAATCTT
GGAAAAGGGTAGAGACATGAAAACGGAAGCTCGTTACCAGTGACTTTTCATCTCGGGATT
GCCTTCTCCATTTCTGCCCGTGATTTTTTTTTTTTTTTTTTTTTTTTTTGAGACAGCTTT
GCTCGTTTCCCAGGCGGGAGTGCGATGGCACAACCTCCGCCTCAAGCGATTTTCCTGCCT
GAGCCTCCCAAGTGGCTGGAATTACAGGCGCCCACCACCACGCCCGGCTAATTTTGTATT
TTTAGTAGAGACAGGGTGTCTCCGTGTTAGGCTGGTCTCAAACTCCTGACCTCAGGTGAT
CTGCCCACCTGAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCACGCCCAGCCA
AATACTGTTTTTCATGCCTTTTGCCCCAGGGTGAGTCCAAAAAAGGCTTTTGAGATTTGT
GGAGGGAAGTTGACACCACCTAGGGTTCCCATGTGCCTCCTTAGGGAGGCAGCCATGGGC
CATGGAGGAATGGTAGCCACACACCTGCTGAGGGTTCTGGGCCTTGCTGAGTCTCTCAAA
CTCCAGCATCCTGCTCTAGAAGTGGATTTTTGTCAACAGATGAGACGGACGCTCCAGAAA
ACACAACTTTATTCACTAGGACTGAAAACAAAGGCTTGCAATCAAAAGGCCAAGTTGAGT
GCAAGGTGGAGCGTGCTCGGAAATCACAGACCTCAGCTGTGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved