Pan_troglodytes Locus Mono:183:SNORA25
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:183:SNORA25
Pan_troglodytes
Mono:183:SNORA25
3
SNORA25
1001..1126
2126
TAGATTGCCTCAAGGTTACCATGGGGTAAACCACCAGTGCCTTCCCAACTTAGTAAGAT
GCTGCTCCCTGAAAGGAGTGATAGATAAGGAAGACCACATGCCAAAATCTGAGAGACATT
TCCACTAAATGCAATGTGTTGGGACACTAACAGTAAACACATTCATAGGCCAGGGATGGT
AGCTCATGCCTGTAGTCCCACCACTTTAGGAGTCTGAGGCAGGAGGATTGCTTGAGCCCA
GGAGTTTCAGGCTGCAGTGAGCCATGATGGCACCACTGCACTCCAGCCTGGGCAACAGAG
TGAGACTCGTGTCTCAAAAAAAAAAAAAGAAAAAGAAAAAAACCCACATTCCTGATGATA
CTCACTCGGCTCTTGAACCATGGACAGCCACGAGGAGCTTACTTATCCTCATTCTAACCA
AGCAACTAGGCAGAAGTCCTACTAGTATAGACAGGCTGGCTTGATCTAAACTGATCTAAA
CCAAAGTTTTACCTTACTACCCCCAACCCCCACCTGCCTCTTTCTGTAACCATTCAGTGA
CAACTACTAGGACTTGATGTATCCACTGCCTAGCCCAGGGGCATCTTGGGAGATGAGTAT
CCTGTCAGACAGTACCCCTAGAACAGTACATGCTGGAAGAAAAGCTCCCTTATGTACCCC
GTGTGACAGAGAGAACAGGAACTGCCGGCTCACTGGGAGAGCTGGTTACACAAGCAGGAG
GCAGTCAGCCTTCTGTGACTGCACTGCCCTCTGCAGAAGCTTTCATTTGTTTAGGCATGT
TCTTGAACTGGTATTGCAGTCAGAAAATCCTACAATGAAAACAGGAAAAAAGTTTTGCTT
CTTTCAGAAAGCCCACTAAGGGCCAGGTGTGGTGGCTCATGCCTGTAATCCCAGCACTTT
GGGAGGGTTTGAGGCCAGGAGTACAAGACCAGACTGGGCAACATAGCAAGACCCCCATCT
CTAAAAAAAATTTTTTTTTAATTTTTTTAACAAGAAAAGATAGGTCATTTCAAAGAGGGC
TTGTGAGGCTGTGAAACCAAGAGCTCTACACTGTGACCAAAGATGGAAGTTCTCTATAGG
ATGCCATGGCATTTGATGGTGCTATGTTTTCTTGAGGAGATATAAGAAAAAAGAAAAAGA
AAAAAAATGATAAAAGAGAATCCACTAGGCACCAGAAATTGCTCTGGGGAGAGTGCAGAT
CAACCTCCACCCAGTTGTCTCTCAGCCTGAGGGGGGAAATCTGACACTTCCTCTGCAGCG
GAGGGAGAGAAGAACAGCCCACATATCTGCCCAGTGACAATCCCAGGCCTTGAAAGAGCT
CACTGCTTCATGGAGGAGTGAAAACAGACTTCATATATCCTAGGAAAGACTCTGCAACTT
AAGGGAAAGGGAGCATTGTCCTGACATCTTAGAGAGAAAATACTGCTGTGAAATGTTTTT
ATATCAGAACAGAGAAAAATTTTAGAAAATATCCACAATTTATGGAGCAATGTACCAGAG
ATAAGGAAGTTGTACCAAGAGAGAGTTCCAGAGATCTGCAGTGTTCCCTCGAGCCTTTGC
AAAGTATTGCTTTCCACAGTCTTAGGAGGAAGCTACATGAGTCCAGGGAAAGAGCCCTTA
GAAAGATGTGGGTGAGCACAGTCTAAAAAGTCAGAATGTATTACCTGCTGCATACAATAC
ATGCTACAACACAGGCGAGCCCCAAAAACATTATGGCCAGGAGAAAAAGCCAGATGCAAA
AGACCGCATGATATAACAGGATTCCATTTATAATGAAATATCCAGAAAAACCAAGTATTT
TTCCTTTTTTTTTCTTTTGAGCCAGCGTCTCACTCTGTCAGCCAGGCTGCAATGGTGCAA
TATTGGCTCAGCACAATCTCCGCCTCCCGGGTTCAAGTGATTCTTGTCGCTTCAGCCTCC
GGAGTAGCTGGGATTACAGGCGTGTGCCACCACACCCAACTAATTTTTGTATTTTTTATA
GAAACAGGGTTTCACCTTGTTGGTCAGGCTGGTCTCAAACTCCTGGCCTCAAGTGATCCA
TCCACCTTGGTCTCCCAAAGTGCTGGGATTACAGGCGTGAGTCATCACACCCAGCCAGAA
AAAGCAAATTTATAGATACGGAAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved