Pan_troglodytes Locus Mono:300:SNORA2
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:300:SNORA2
Pan_troglodytes
Mono:300:SNORA2
20
SNORA2
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGCTCCAA
GGTCTAGAGGGGCTTACTGGGGTGCCAGCAGGGTATTTCCTGTAGACTCAGGCAGACTCA
GGCCAGAGAAACCCAGTCCTCAGGAGAGCAGTGTGGGCTGGCGGGCTCTGGAGTCAGACA
TCCCGCTCTGGAAGATGACCTGAGTGGCTCTGCCTGTGGTGCACAAGCTCCTTGGGCTGT
AGCCTCCTTATCCTCAACAGAGAGCCCATGTCATTGTGCAAACGTTCACCTCGCTAGGGG
CACAGTGGAGCCAGGTAACCCTGACTCAGCGCTGCTTCCCAGGGAGGGGACGCAGCTCTG
GGCGAACTCTTTGCCACTGTTCTGGAGGAAATCCAGCTGGAGAGCACTGGAAGTGGAGGG
CCAGTGTCTCCCAGGTCAGGCCCAGTGGCTCATGGGTCTGCAGCTGCTGATGATCAAATG
AAGATCAGAGGTGTTTAGGCAGAAAGGAGGCATTCTGGACTGGAACAGAAGAGGGGGAGG
AATCAGAGGGTGGAGGAGAGCCCGGGAACCCCTCAGTAATGGGGAGTGGGAGACCAGATA
CCCACCCCACCCCTCATTTCATAGTAACGAAACCAGGGCCTGGCAGTGCAGCCTGAGCTA
GGGACACACCAAGCTCAGTCTAATTCCAGGCCCACATCCCCTCCACTCCTCCCTCCAGGC
TGCCCCCTGGCTCACCGGCTGGATGGATGAATGAGCAGGGTACCTTCTGTCCACAGCAAA
AGGGCACAGAGAGAAAACCCAGAGGAGGGAGCCTCATGTAGCCAGGTGGAAATTAACAAT
AATACTCAGATGTACAAAATACTTATTTATTTCTCTGCAATTTATCTAACCATTTTCACA
AGACTCCATGAATGTAAACTTGCTAATTAAAGAAACCCCATTAGGCCCTGAATCAAGACT
AGTGTTTTGCTGTAGCTGTTGGTTTCAAACAGGATCCGAGAGTGATGTCTTCCTTGTGGT
CTGTTCACTGCTCAGTATCCCAGTGTCAGTGGCCAATTCAGTTGGAAGCAACATGGTCTT
GAATATAAAGCCACTGTTTTTTTTTAACAGAGCAATTTAACTATGTTAGGCTTAAGAATC
AGGAACTTACAGGCCGGGCACAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTG
AGGCAGGCGGATCACCTAAGGTCGGGAGTTCAAGACCAGCCTGGCCAACATGGAGAAACC
CCGTCTCTACTAAAAACACAAAATTAGCCAGGCATGGTGGCGCATGCCTGTAATCCCAGC
TACTTGGGAAGGCTGAGGCAGGAGAATCACTTGAACCCGGGAGGCAGAGGTTGCAGTGAG
CCGAGATCGCGCCACTGCACTCCAGCCTGGGCAACAAGAGTGAAACACAGTCTCAAAAAA
AAAAAGAATCAGGGACTTACTCTGTGGAGATAGGGACTTAACCAAAATAATATTTATTAG
CCACTCAGCGGAACTTGGTCCTCCTCCTTTCTTCCCACCTCCTCCCTTTCCCCCTCAAGA
TCACTTGCTCGCTTTGTGACTGTTAGGATATTGACCATGCAACCTCATACTGCCTGATAA
TTTTTTTTTTTTTTTTTTTTTGAGATGGAGTCTCGCTCTGTCACCCAGGCTGGAATGCAA
TGATGCCATCTTGGCTCACTGCAACCTCTGCCTCCTGGGGTCAAGCGATTCTCTCCTGCC
TCAACCTCCCGAATAACTGGGATTACAGGGGCCTGCCACCACGCCCAGCTAATTTTTTAT
TTTATTTTTAGTAGAGAAAGAGTTTCACTGTGTTGGCCAGGCTGGTCTCAAACTCCTTCC
TGACTTCAAGTGATCCGCCTGCCTTGGCCTCCCAAAATGCTGGGATTACAGGCATGAGCC
ACTGTGCCCGGCCTGGCTTGGTTTTTTGATGTGAAACATGAAGATAATCACATGCATATC
TCACGTGGAATTCAGTGACACAATCATGCTTCTAGAGAGTTTAGCACAGTCCATGGAACA
TTATAAGGTCTTATCAAATGGGAGAGATCATCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved