Pan_troglodytes Locus Mono:292:SNORD74
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:292:SNORD74
Pan_troglodytes
Mono:292:SNORD74
10
SNORD74
1001..1078
2078
AAACACAAATTCCAACTTTAATGAATGCTAGAGACATTTGTAGCCAACAAAAATATGAA
GATGAAAAGAGGTGGAAGGATAGTAACTACCTATAGGAACAGTAGAAAGTGAAACAAGTG
CTTGCAGAGAGATACTGATGAGAAGAAAGTTGATTGACTCTGCCTAACCCTGAAAAGACA
CAGAAAATGGAGTTATCCAGTACTATAAAAAAGGGAGAAAAATGGAAAATTGAGCCTTGG
GATTTTGGATCTCTTGCGCCACAATATGAATGGACAACCAAGTATTTCCAGACATTTACA
GTAATATAAAAATAGAGATTCAAACAACCTGAAAAAAGGAACTTGAAGAGGAAAAAAAGT
ATAAAAGCTGAAGAAATCTTGAAATTTAAAACACTGTAATTACTCCTCTCAGAATGATAA
GAATATATTGTGTGTATAAATCAGCAACAGGAAGCCACATAAAAGAAAAGTTCGGCCAGG
CACAGAGGCTCACGCCTGTAATCCCAACAGGCTTTGGGAGGCGAGGCAGACAGATCATGA
GGTCAAGAGATTGAGACCATCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAAATA
CAAAAATAAGCTGGGCATGGTGGTGCACACCTGTAGTCCCAGCTGCTCGGAAGGCTGAAG
CAGGAGAATCGCTCAAACCCGGGAGGCAGAGGTTGCAGTGAGTCGAGATCGCACCACTGC
ACTCCATCCTAGCAACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAGAAAGAAAGAAAGA
AAAAGAAAAAAAAAGACAGAAAAATTCAGAGAACAAGAAAGAGATCTTGGAAATAAAAAT
ACAGCTGCAATGACTTTTTAAAAATCAATAGAGCAATTGGAAGATACAAACCAAGAAAAT
CCCTCACTTTTCTTTGAAATTAAGGACTTGTTAATAATAATACAGAAAACTTCCTCCCAG
AATTTAGAAAAAAAAGAGAAAGCTTTTTGCAATCAAATTATCAGTCCAGCCTCTGATGAA
GCCTATGTTAGTAGGCACATCTGAGTGGTAATGAATGCCAGCAGCTCTGATGAAAAAAAC
AGGATCAATCCAGAAGATGAGTTCCAGAAAGGAAGAAGAACAGAGAAAATAATGGGAGGG
AAATTATTATATATACACACACTTAATTCCCAGAATTAAAAGACATAAAACTATAAATTA
AAAGGATCCACAATTACACACAATGAATATTAAAAGATCCCTAGGACACATTATCATAAA
ATTTTAGAACATCAAAAATGAAAAGAAGATCCTAAAAGCTTCCAGACAGAAAAACAGGTC
CCATAGAAATGACAGAAATCCAAATGGTATTTGGCTTTACAACAGCTATATCAGAGGTGG
CAGCATAGGGGAAAGGTTGGAAACCTGGCTGCTGGGTTTGAATCCTGACTCTATACTCTG
TGAGTAATGATAGTGTTGTTATGAGGATAAGGTAGGTTCATATTTATAAGCGCGCAGAAC
AGTGTCTGGTACCTAATATTTGCGATTTAAGTATTTTCTAAATATACTTAGAGAAGATAA
ATTGAACACGTATTCTAAATTCTGAGGGTAAATGAGTAAATGAGCTGCCACTTGCAAGTC
AGTACCTAACTAAAACTCTTAAATAGGTATAAGAATAGAAAAAAAATCTTTTTTTTTTTT
TTATACAGAGTCTCTTTCACCCAGGCTACACTGCAGTGGCGTGATCTTGGCTCACTGCAA
CCTCCACCTCCCAGGACCAAGCGATTCTCATGCCTCAGCCTTCCTAGTAACTGGGATTAC
AGGTGCTCGCCTGTAATTAGCACCAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTC
GCCATGTTGGCCATGCTGGTCTTGAACTCCTGACCTCAGGTGATCCGCCCACCTTGGCCT
CCCAAAGTGCTGGGATTACAGGAATGAGAAAAAAAAAAACATATTTTCAGGCATGCAAAG
TCACCCCCAAAATTAACTTCCTCTGCACCTTTTCTCAGGAAGCTCCAGAATTACAAGCAT
CACTGAAAATAGGGATTAAACTAAGAAAGAGGATACAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved