Pan_troglodytes Locus Mono:3:SNORD32
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:3:SNORD32
Pan_troglodytes
Mono:3:SNORD32
6
SNORD32
1001..1082
2082
ACTTGCCCAAAATGCCACACTGTATCTTTTCCCACCACTGATACCTTTAGTGCCCCAGA
GTCTATTGAGTCACATGACCAAAGCACTACCACACGGCTGATATGACAGCTTAGAACAGC
TGCGGACCCCAGGTCTGCTCTGGGCTTCAGTCAGTCGCTAGTAAACTGTTCCATGTGGTA
TTCCCATGAGTGTGGAATATGTTTCCTCTAGATCCTAAATAGGACAACCAAGCATTCTCT
ACCCTGGAGAAGAGGAAGAAGAAGACCAAGATTCACTGCTGGAAGAAGAAACAGCCTATG
AGGCTACAGAAACAGGCAGAAAAGAACGTGGAGAAGAAAACTGACAAATACACACAGTTC
TCCTCAAGACCTATGGACTCCTGGTCTGAGCCTAATAAAGACTGTTTATTCCAAAAAACA
CCTCTGTATTATAAATTCTTCTGTGTAATAGTGTGTTACTGTGCATCTCTTTCCAATTCT
GCATTACTGGTGTTAAGTGTGAAATGCAATAATGTGTTCTTACTTTAGAGGGATGTCCTG
GCACAAAGTCTAAAAACTTCAAAGATGTGGAGGATGCTGAATCTTCACAGGGTGTATTTC
CCACTCTCTGGAGTGCATTTGTCTTACCAGTGCTGCCAATATGCTTGCCCTCATGGCTCA
TTCTGTTTGGTTAATAAGATATTGTTGATACAGTGGAACGATGTCATGTTTTGTGGAATG
TCCAGAAGGTCCACGTCCAGTGGTGTGCTGCATGCAGCTAGCTCATACTGCCTCATGGAG
CCAACTGTTAAATTTTCAGAAATTGTGCAAACCAGTTGTTAAACATGACTATTATTTTAA
AATAAGTTATTTTAAGGCATAGGTAACAAATCCCTAAGCTCTTCATTTTCTAGGTATTTA
ACTATCTTACCATATTTTCTATACTCTTCTGGTTATTTATATTTGTTATGTCTATATAAT
AAAGATACTAAATAATGTTGTCTGTATAATAAAAATATTCTGGATTGGTGATGAGCAACA
ATGACCATCTTTCGTTTGAGTCTCATGGCCATGAGACCAACCCCATGCACTGCTCTGAGA
CCTGCCAGCCACTCCCGTTCCTGGGGTGCGGTCCTCCTGGTTCGGAAGTGATTTTCCATT
AGGCTATCTTTTAATTTAAACATGAACTCTGCTGTGCCCATCACTGTCTGTGTGCAGTCA
CAGGTAGAGGGAGAGCCTTCAGATGGCACCCTCAGCACTTCCCAACCCTTTCCCTCCCTC
TAGGCCAGAAGCTGGTGGTCGTACAATGCGAGAGCATCAACATTTCTGGCAAGTTCTACA
GAAACAAGTTGAAGTACCTGGGCTTTCTCCGCAAGTGGATGAACACCTTCTCGAGGCCCT
GCCATTTCTCGGCCCTAGCCGCATCTTCTGGTGGATGGTGCAAGGCCCACTGCCCCACAA
GACTCACCAAGGCGAGGCCGCCCTCAACCACCTCAAGGTGTCTGACGGCATTCCACCGCC
CCATGACAAGAAAAAGCTTTGGTGGTTCCTGCTGCCCTCAAGCTTGTGTGTCTGAAGCCT
ACAAGAAAATTTGTCCGCCTGGACACCGAGCTCATGAAGTTAGCTGGAAGTACCAGGCAG
TGACAGCCACCCTGAAGAAGAGGAAGGAGAAGGCCAAGATCCACTACCAGAAGAAGAAAC
AGCTTATGAGGCTACAGAAATAGGTGGAAAAGAACATGAAAAAGAAAACTGACAAATACA
CACAGGTCTCCTCAAGACCCATGGACTTCTGGTCTGAGCCTAATAAAGACTGTTTGTTTA
TTCCTCAAAAACAAAAAACAAAAAACAAAAACCCTCGTATTATAAATTATTCTGTGTAAT
GGTGTGTTACCGTACATTTCTCTACAACTCTGCATTTTCAGTAATCTCACATTGACAGTT
TAAAATTGGCCATGGTGAGAATATTTACACTGCAGAAATCAGCAAATGATGTAAATCAAG
GCTTTTTTGCCTGGACTTGCAGCACATCCATGTCCCATTGGACCCTATTATGACGGGAGA
GTTTTAACATGGTACTGAAGCAAAAATGTAAATGTAAATGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved