Pan_troglodytes Locus Mono:108:SNORA73
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:108:SNORA73
Pan_troglodytes
Mono:108:SNORA73
8
SNORA73
1001..1209
2209
CTCTCACCAGCAATGTACAGGGGTTCCAGTTGCATCACACCCTTGACAGCACTTATGAT
TTTTTCTGATTTTTATTTTTCTGTAATAGTAATCCTAACGGGTGTGAAGAAGAGTTTGAA
ATTATTGAGTTAGGAGCCACTGCATGATTTTGACGAGGGAATGACACAATCCCTTTTCTT
TTTAAAAAGATCACTCTGGCTGATGGATGGAGAAGAGATTGAAGGGGAGAAGAAAGCAAT
GGGGCAGACTAATTTTGAGAACATTTTGGTGTCCAGGAAAAGAATGATGATGGTATGACC
TATGGTAGTAGTTCTGAAGAAGAGAGGACACAGATTCAAAATATACTTTAGGGTGAGGGG
TGGTGGCACTTGCCTATAATCCCAGCACTTTGGGAGGCCAAGGCAGTCAGATCACTTGAG
CTCAAGAGTTTGAGACCAGCTTGGCCAACATGGTGAAACGCTGTCTCTACTAAAAATACA
AAAATCAGCCAGGCATGATGGCGTGCACCTGTAATCCCAGCTACATGGGAGGCTGAGGCA
GGAGAATCGCTTGAACCTGGGAAGTGGAGGTTGCAGTGAGCCGAGATCGCGCTACTGCAC
TCCAGCAGCCTGATGGAGACTAGGGAGGCAGGCACCAAATTTGGCAATCAATGCCCATAA
AATATTCAGTGCAAACATCAAGAGACAGAAAATGGGATTGGTAACATGGATACTGAGGAA
ACCAACTCAGAAAGGTTAAGTAAGTAACTTAAGTTCACACAGCATAAAATGCAAGTGGCA
GAGTCAAGAGGCAAACCCAGGACTGTCTGATTACGAAGACTGGTCTCACCATTTTATGTC
ACTTCCTTCCAGTCAGAGCCGACCAGTCTCCAGGAATTTGGACTGCTGACTGCATTTATC
AACTTTGGGAAATCTCTAGTAATAAAAGGGAGACACGCTGAGTAATAAGTGTGAAGTTTA
GAACACAAACCTTGCAAGAGCTTTCAAGAATAAATAAAATTCCAACATGGATAGCCTGGG
AGGTCACTCTCCCCAGGCTCTGTGGAAGTGGTGTTGGGGAGCATAGACGTTTGGTCCATG
AAGTACAGTACAGCCCCTTTCCACAATGTTGGAGATGAAGCTGGGTCTCCTGTCTGCGCC
TGCATATTCCTATAGCTTCCCTGAGTCCTGTGGATGATGACTGGTGAGACAAATCGTGCA
GGAAACATGTTTAGTTTGAAAAAAAAATTAAAACAACAACAAAAAAACCCAACATATTTG
GAATGTGATAGACAACAAGTGAATAGACAATCTCACTTAGAAATTGTATTTAATAGAGTT
AATAAATTCAGTTGCCTTTTGCTGGGGAGTAATGAACAATTTCATCTCCCCCCCAAAGAC
TCTGGAGTCAAAGGTGGTGTTTAGACTCCGTTACCTGGAGCGCTGGTCTCTCATCTGTGT
CAGGTACTTGACACAGAGGTATTTTACAGAGGAGGGGTGCTAAGTCACGAGAAGGATGAA
CAGGAAGAGAAGAGTGATTACAGGCTGGAGGTTAAGAACAGAGATTCCGAAGTTTCACAG
TATGAGTAGGAACTCACTGACTAGCTGTATGCTTGGCTAATGCTTCATCCTCTCCAACAT
TCAGCTTCATCATCTGTAAAAGGAATCCCGTAATGTCTATGTCTCAGGGATCCTGTGAGG
GTGAGGTTAGGCATTGCACATGAAGGGCTTAGCTTAGCAAGTACTAGCTGCTTGTTAATC
TTTATTACAATGGCATTTGAGCATATGCTTTACCTATGGAGCACATTTTACCTCTGAGCA
CCCTAGAGAAAGGAGAGTTTGGCAGTTTAGCAAGGGGGTCAGGGGACGTAGGAGGATGGC
TACACAACGTACACTAAACTCACAATTAGGGAGTACAATCATGCTTTGTTCCGAAATGGC
AAGTTTTTTGACAATGTGTCTTTATATCCATTGCTGGGTTTTTTTGGTTGTTTGTTTGTT
TTGTTTTGTTTTGTTTTTAAGATGGACTGTCTCTCTGTTGCCTAGGCTGGAGTGTAGTGG
CGCGATCTTGGCTCACCTCAACCTCCGCCTCCCGGGTTGAAGCAATTCTCCTGCCTCAGT
CTCCTGAGTAGCTGGGATTACAGGTGCCTGCCACCATGCCCAGCTAATTTTTTGTATTTT
TAATAGAGACAGGGTTTCACCATGTTAGCCAGGCTGGTCTCGAACTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved