Pan_troglodytes Locus Mono:90:SNORD37
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:90:SNORD37
Pan_troglodytes
Mono:90:SNORD37
14
SNORD37
1001..1065
2065
CCTATGAGTGAGTACATGCGGTGTTTGGTTTTTTGTCCTTGCGATAGTTTGCTCACATT
GACAGTTTCCAGCTTCATCCATGTCCCTACAAAGGACGTGAACTCATCTTTTTTTTGGCT
GCATGGTATTCCGTGGTGTATATGTGCCACATGTTCTTAATCCAGTCTATCATTTGTGGA
CATTTGGGTTGGTTCCAAGTCTTTGCTTTGTGAATAGTGCCGCAATAAACATATGTGTGC
ATGTGTCTTTATAGTAGCATGATTTATAATCCTTTGGGTATATACCCAGTAATGGGATGG
CTGGGTCAAATGGTATTTCTAGTCCTAGATCCCTGAGGAATCGCCACACTGTTTTCCACA
ATGTAAAACCACTGTTTATACAAGAATGGTCTGCAAGCCATCTGTATCAGACATGTAGTA
TGTGTCATAAATTACAGGTTGAGGAGCCATACCCTAAGTCTACAAGGACAAAGACAGGAT
AATGTATTTTTACATACAACCCAATTTTCCTTACCCATTGTAAAGTTTGAGTAGCTCTGC
TTAAACCCTATCATGGAGAAGAAGACATGATGAGATAGTCATTTTTCTGCTCAAAAAGGG
TTATGTGTTTGGCCAGCAAAACAGAAAGAGAATTGGAAGGACATAACTGATGTAGAGATA
ACTGTTGTTCCCCGAGAAGGGTCCAGAACTCCAGCTGGGCTGAAAGGAACAGTTTGTGGC
CAGTTGCAGTGGCTCACACCTGTAATCCCAGCACTTTAGGAAGCCAAGTGGGGTGGATCA
CTTGAACACAGCCTAGGCAACATGGTGAGACCCCATCTCTACCAAAAAATACAAAAGCTA
GCCAGGTACAGTGGTGCATGCTTGTAGTCCCAGCTACTTGGGAAGCTGAGGTGGGAGGAT
TGCTTGACACTGGGAGGTCGAGGCTGCAGTGAGCTGAGATTGCACCACATCACTCCAGCC
TGGGCAACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAGAGTTCATGATAAGTAACATT
TCTTCAATTTGACCTGATGTGTATTGAAGAAAACCAGCATCTGAGGCGCATGGAGAAAGA
AAAAGAATAAACTTGGACAAAGAAACAGACGTGCATAAAGGGAAGACAATGGAAAGAGAC
ACAAGGAGTAAATGGCCATCTGCAAGAAGAGAGGCTTGGACAGATACTCTCTGCTCAGCC
CTCAGAGGGAACCAACCCTACTGACACTTTAATTTCAGACTTCTAGCCCCTGGTATCATG
CAGAAATGGGATTTAGTTACAAAGTTTACAGTTTTCCAGAGGAAAGACAGCCTGGAAAGC
CAGACCCCAGTTCTTTGTGTTCTAGAATCCTTTCAAATTTACTCAGGATTTTCACTGCTC
TTTCTGTCACCTAAGGACATCAGTGGTGAATATAGCAGGGCTACAGACTGACTTCCAAGA
CCAGGTGACAATTGCTATAGCTCAGCTAAAGGAAGACAGGAGCACGAATGGCAAACAAAT
GCAATATCCCCCAGATGCCTGGAGCACACACATCCTGCTTATGTTTCCTGTGGGGCAGAA
AGGTGAATCAGGGAGGGAATCTTGAATCGACTGAGCACTAGTTTCCAAAATACTGCTTCT
TATAACGAAAGTGGCTGAGTGATCTTGGATTGACAAGCACTCACCGTCAGCAAAAATCTG
AGTTTGAGAATGTATGCAGGTATAAAGAAACAAAGGAAGACATATTTTTTACATAGCTAA
GTTTATAACAGTATAAATACTGTATGATTTTCATTTCAGCAAATGTGCTGAATGTGCTTG
GCACTTAATTAAGAGTTGGGAATACAGCGATGCATGTCTCTCATGTATTGACTCATGACT
GGTGCCAAAGCAGTTTAAGGCACATTCCATGCATCATCACCATCCCACACATCAGATCTA
CATGTAAGTTTCATTATCAATCCTCAGCAAATTAACAAACTGAGGATTACCAAGATTTTG
CCAAGGTCACATCATTGCTGATTGGTTGGCAGGGATCAAACCCATTGCTGATTGGTTGGC
AGTTCCACTCAACTCTGCTGCCTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved