Pan_troglodytes Locus Mono:181:SNORA43
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:181:SNORA43
Pan_troglodytes
Mono:181:SNORA43
3
SNORA43
1001..1125
2125
AATATACTGAAAACCACTGAACTGTATGTACACTTCACGTGGGTATGAATTATATCTCA
GTATTATATGAATTATATTTCAATAAACTGATTAAAACTCAATGTTATAAATCATATCAC
AGAAAAAATAAAAATATAATAATCTCAATAGATGTAGAATAAGGAAATGACAATTCAACA
CACCTTCATAATAATAAACTAGGAAGGGAAGAAATGTCCTCAACCTCATAAAAGGCATCT
ATGAAAACCTATCACACTTAATAGTGAAAGACTAAATGTTTTACCTATAAGTTGGGGTAT
TCCAGAATTAAAAGAACATATATTGATACAATAGTACTGTCACTCAAATGATTTTTGAAG
GCAATTATTCTTCCTTCTGGGGAGACAGACCCTTGAAAAATCAGATGAAAGTTAGAGATC
CTTTCTTAAGAAATTCATTTAAAAAAAATATTGGAGAAAGGAAAGGATGTTTGCCCACAC
CACTTTTATTCCACATCGCACTGGAGGTTCTAACCAATGCAACTAACCAAGGGTAGAAAG
ATAAATAAAAGGCATATCGACTGAAAAAAATAAATAAATAAAACTGTTTTTATTGGCATG
TAACTTGATTGTGTATATAAAAATCCTATGAAATCTATAAAAAAGCAATTAGAAATACGA
GTTTCACTAGTTAATAGTATACAAGTATATATACAAAAATAAATGTCAAAATGACTCTTT
AAAATAGTAATAAACAATGAGAAATAAAAATTTTAAAACTACTCACAATAGCACCAAAAG
ACATGAAATATTTAAGGATACATTTAACAAAATACATGGAACACACACACATAAAAAAGT
AGACAGCACTACTGAGAGAAAGTAAAGGAGGCCTAAAGAGCCATACCATGATTGTGCATT
AAAAGTCTTAATATTGTTAAGATATCAATTCTAAGCTGATCTATGTAATCTCACTCAAAA
TCCCAAAAGGTACACACTAATAAACTGACCGCCCTGCAGATGCTGTCCTGGACCTGCCAG
GATGCTCTGCTATGCCTGTAACATCGGGGCGAAGTGAAAGTGGCTATGTCTACACTCAGT
GTTCAGAAAACAGTGAACAACAAGAATGGATAATAGCCTGACATTTCTTAGGGGAACAAC
AACAACAAAACTGAGTCTAACATTTATGTGGGATTGCAAAGGACCTAGAACAATTTTGAG
AACACAGTTGAAGGACTTATACTACCTGATAATTTTAAGACTTACTATAAAGTTACAGAA
ATCAAGAGTGTGTCATGAGTGAAAGGACAGATATATAGATCAGTGGAACAGAATAGATTC
TAGATAGATTCACATGTTATATACGTGGCCGACAGGATTTGACACTGGAGGCAAAGTAAT
TCAATGGGGAAAGGATAGTCTTTTTAACAAATGGTGCTGAAAAACTAGATATACATATTT
TTTAAATAAACCTTGACATTTACCTTCCACCATACAGAAAAACTAAATGAAAATGGATCA
TAGATTTAAATATAAAAGCTAAAATTAAAAAACTAGAAAATAACACAGGAGAAAATTTTT
GTGATCTTAGGATAAGCAAATATTTTGTTGACATGCAACACAATTGTATACATAAAAAAT
CATGAAATGATACATAAGAAGCATAAATCATAAAAAAAGTAAATTAAATTTCATCAAAAT
TAAAACTCTCTGCTCTTCAAAGACATCATTAAGAAAATGACAAGGTAAGCCACATGCTAA
GATAAAATATTCACAACACATATATTTTAAAAATTCAGTATCCAGAATATATAAATAACT
TACAAATCAATAAAAAGAGTTAAGGGGCAGAATATTTCAACCGAGCCTTTATCAAAGAAA
ATATACAAATAGCAAATGAAAATATCAAAAGACAGCAGACACCACTAGTCACAGGAAAAT
TCTAATTAAAACCATCATGAGATATCACTACTACACATTGACTAGAATGGCTAAAATTAA
GAAGAATGAAAATACCAAGTGTTAGCAAGGGTGTGGCAAAAGTGGGACTCTCTCACAATG
CAAAATGGTTCAGTCATTTGAAAAACTGTATGGCAGGTTCTTATAGTTACATTTACCATA
TGACCAGCAATTCCACTCCACCCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved