Pan_troglodytes Locus Mono:10:SNORD65
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:10:SNORD65
Pan_troglodytes
Mono:10:SNORD65
6
SNORD65
1001..1073
2073
GAGACCAATGCTGAACCTTCAATATCATATCCCTTGAATAGATCAACCAGGCACTTTGT
GGAAAAGAATTATATATGACTACTTTCAACTTGAGATCTGAATCATTTGTCCTGAATGAG
TTTAGTATGTGTTCTAGGTATGCATTTCCCTTTTCTGGAAAACATTTTCTCTATGAACAC
CACGTATAGAATCACCACAGAATATCTGGATTAATAAAATTAAATCCTGCAAAACATCAC
CTCAGATGAAAAATCTAACATTGTGGTAAATAAGGTACAAGAATGTATCCTGAACCAAAG
GACCTACTTGTCCTATTATGTATCATTCGGAAGATACTATCATAATAAATCATTGGAATA
GATTTTTAAAGTTTCAGTTAAAATTCTAATTTGGGAACAATATCTAGGAAAATTAGAGCA
CTGTTTTTCAAAATGTGGTACCTATGTTACACTAATAATCTTATTTGATGCTGAGAGATA
ACAGTGACTAGGATCAGGAACCAGTGAAAACAGAATTGGTCATTCTCACCAAAAGCCTAC
TTACAGACTTGGAAATATGTGCTTTCTTTGAAACGCAGTCTATGTAATTCTGAAAGTCCA
GGTAACTACAAGTAGAATGGTCACGTCTCCAGGGTACAAGAGCAGGGTCTCAAAGAACCT
AGATCTAAATCCAGGACTGATAACTAATCATTTTTGGCTCCTCATGCTATACTCAACAGG
AATATAAAGGAGTTACAATGATGGCAGAAGTAATTATCCTTAGTTATCATAAAGGGCCAG
AATTGCTATTACACAATGGAGCAGTGATAAGTATGTCTGAGATTCAAATGAGTCACTGGA
ACACCTCCTGGGGCTTACTTGCTTAGTACAACAACCATAGCCTGTCAAGGTCATGATATC
CAGGAATTTCAAGCATTCTAGTTCATAATCAAAATTTAACACAGATTATATTCAATTACT
CCTTGTGTACACAGGCATTTATCAAAAATGTATTGGAGATCAAATGATGAACTCACCTAA
AATAGCTGTAATTACCAGCAGATTATGTAATGGCAAACCTACAGTTTTCTGAAGATTAAA
ATAATAAAATTAAATATGTATGTATATGTGTATATATATATGTAGCAGAATTCCCATGCA
ATTATAAAATAATTCATATATTTATGCCTATGTGTTTATGTGTATAAACACACACATAAC
ACAACTTGGGTTTTTTACATTGTATTATTTTAGTTACATATTACATAGCCATGCAAAATC
GAGCAACTAGAACTAGTGAAGTCTGCAAACTCATCTTAGTTAATGAATATGAATACAACT
TGTGATTATACATTCCCTGTGAAGCAAAAATACATTGGAATCAGACTTTCAGTGTTCTGT
CATATTATCATACCTGTATAAAGTGCCTATTTGTTTTATCAACCCAAATTTACAAATAAT
TATAAACTAATCTCTCAACATGCCCTTAAGGGGAGCATCGACTTATATTTATTGGAATTT
TAAATAAGCATAGGCCACTTATCTAACGTTTCAAGCAATGTCTATAACAAATACATTGTG
TTATTACATAATATATCAATAATTAGATATCTCATTTAACATAATGTAAAATTTGCTACA
GAGTGTTAAAAACCATGTTTTTCTTATTCAACTTGCTGTTTGAAGTAGAAGACAAACACG
GGCACATGCATTGTAAAGGTCCATTATATTTTTACCATATTTTCAAAGAGAAATAGTGTT
CCATCACGTTTTCAAAGAAAAAATAATAATTTAGGTGTGAATTTAAAGAAGAATCAAACT
GCAGTAACATACATTTATTTATTTATTATTAAAAATAATCTGGGATACTGAAACCTCATA
TATATTAAAACAAAATTTGGAACTTAAGACATGAGGATTTTTTAGAGCACACCAGGGATA
ATAATTCAAAATATTCAGAGGTCAGAAGACTGTAAGAAGCATCATTTTTCTTATAATATT
TTTTCATCACACAAACTCCTGAAAGAAAACATGATGATCTCCATTCTTACACGAGAAAAA
TGAGACTGAGGAAGCGTGAGATAGGACACTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved