Pan_troglodytes Locus Mono:0:SNORA67
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:0:SNORA67
Pan_troglodytes
Mono:0:SNORA67
6
SNORA67
1001..1142
2142
CATAGGCTCTCCTTTGAGTCATTAGGGCCATCTAATCATCCATTCTAGAGCTTCCCTGC
ATGCAAGCCGTTTATCCTCCAGGCCATTCCTCATCTCCTTCTCCTTTTCATCAAATGTAT
CTGCTATGCGTCCTATTCTATCGATGTTCATTCACTACCAGTCCACATGAAACTGCAATT
TGCTCGTCACTATAAATAGAATTGTGGTACGTAAGATGGAGAGAGTATCTGAAATGAAAC
AATAACTCTAATGTTGAGACTATCAGCTTCCCGGAAAGCCTAGGGTGGAAGATAACTGGT
GATGATGCCTGTAAGGTTAAGAAGCTATAAGGAATCCTCAAGTCCGTCTGTATTTTTGAG
TACTTTCTAATGGTGCACAGTTAGGCTTTGTTGGAGATATAAAGAGGTAGACATGGCCCC
TCATCCCGGGAGTTTGCAATCAAGCAGGTGGGATGGTGAATTAGGCCATTCTTGCATTGC
TATAAAGAAATACCTGAAGCTGGGTAATTTATAAAGAAAAGAGGTTTGATTGGCTCACAG
TTCTGCAGGCTTTACAGGAAGAATGGTGCTGGCATCTCCTGGGCGTCTGGGGAGGCCTCA
GGAAGCTTATAATCATGGCAGAAGGTGAAGGGGGAGCAGGCACGTTATATAGTGAGAACA
GGAGCAAGAGAGATGGGAGGAGGAGGTGCCACACACTTTTAGACAACCAGATCTCGCCAG
AACTCACTATGGCGAGGCCAGCCCCAAGAAGATGGCATTAAATCGTTCATGAGAAATCCA
CTCCCATGATCCAAACACCTCCCACCAGGCCCCACCTCCAACACTGGGTATCATGATTCA
ACACGAGATTTCGAGGAAACAACACCCAAACTATATCAGACGGAGATCTTGGGAGCCAGG
CACTTGCATCCACCACTTTAAATAATCTTATTTAATTGTGGTGGTATCATTATCTAACTT
TGCAGACAAGGAACCAAGGCTCAGAGGAGTAAACTATTTTTATCCAAGGTGAGTCTCTCT
CCAAGGGGCTGACTAGTGCCTCTCTTAGGACAGTAGCAAGTTGGAATAAAATCTGGCATG
CCTAAGGTCTTTAAGGAACAGGGGATGCTTACTTCTTTTGCGTTCCTTTGGCGGCCTACA
TAGCATACTTAAGCTCCTTCTGGATAGACTGTGTCCTCTTATTCACATGCTGAAGTTGTT
ATATATTTTTAAACAAATAAAAAGTGAATAATACATTTTTCTAAAAAGTAACTGATTTTC
TCTAGGTTCAATACAGATAGCCAGCCATGGGAGTCAGAATTTGAACTCAGATCTGGTCTG
GTTCTGAAGCCTCTCTTCTTTCCAGCTGTGAGACAAAGGAGCAAATATGAGAAGCGCCTT
TTGCTCACTTCTGCTTGCCAGCAGAATTTCACAAAAGCCCTGGACTGTGAAGATGTTTGG
AAAGATGCTTTGAAGACGAAACCTTTAACAGGGTTAGTGTTTATGCCTCTGTAATCTACA
ACCAGATGCACTGTTACACCCAAGCCTTGATGGGATTCTGCTGTGATGGAAATTCTGAGC
AAATTTGATGTGATTGTGCAGGTACTGAACCTCCACTTCCTGTCTGTAAGCAGTGGGCTG
AAATCCTGGGCTGGAGCAGTCTCATAGGATCTGACAGGCTGTTGCCAGGCTGTAGGCCTT
GGTCTGTAGTCCTCAGTAAGACTTCTGAATACAACTAACTTTAATTCTTTAAAAGCTTGA
CTGTTTTCTTTAGTCGGCATGGCATTCCATACCATTCCAGAAACAGAAGCCAGGAGGATA
CATGAAGGAGAGAGCAATGGCATAGTGTGCGGAGCTGATTAGCTGTTAACTAGCAGAATT
GAGAGAAGGCAGCCGGCCAAATGCCCTGGAGGGGCAAGGAAAAGCTTTTTCAGAGAGTTG
GGAAGTGGCACTCCAGTGAGGTCTGAAGCCATGAAGGTTGACTTATTTATTCCACAGTAG
CTACAAGAAGAGGGGTCTTTCTAGGGAGTGTGACCAGTTTAAGCAAAGGCTTGGCAGGAG
GAATAATAACTTGCTGGAAGTGAGAAAGGGGAGCTGGTTAAGGGGCTGAAAGTTATTCCT
TGTGGATTACCTTCTCATCACACGCTCTTTGACCTCATTGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved