Pan_troglodytes Locus Poly:23:SNORA17
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:23:SNORA17
Pan_troglodytes
Poly:23:SNORA17
10
SNORA17, SNORA17
1001..1133, 3761..3892
4892
AAAAAAAAAAGCAGTCTGTCTCACCTGTTCTCACTTCAGCCCTGATCCCCAGAAGCAAC
CACTTAAGAATATTTTAGCTCTTGCTTTTCCTAATGTATGTCTGTATGTCCGAACAGGGT
GCGTATGGCACTTTTTACTGATTTATTTACTTTATCTACTGACCTCCCATCTACTGAATT
CCCATTTGATGCAGTCAATCGCGCAGCAAATATATATTGTGCACCCACTATGTGCCAGGC
ACTGTTCCACGCATTAGGAATCCAGCAATGAGCAAGACAACAAGGTTACTGCATTCATGA
AACTTATAATCTAGGAGAAAGACAAGTAAAAAGCAAACAACGAAATAAAACGATTCCATA
TACTGCTATGTGCTATCAAGAAAATAAAAGAGTGACAGAGATTTAACCGCCTGACTTTCA
GTAGAGTGGTCAGAAACATTTCTCTAAGGCGATGTCAGAGTTGAGCCCCTAAATGATAAG
CAGGGCCTGCCATGTGAAGCTCTATGGGAAGTGCCGTGATAGGCATCAGCACATGTAACA
GAGACCCTCTTTAACAATGGCATAAGCAAGTAAGTCTATTGTTTGCCTCATGTAGTAGCC
TGAGGATAGGCCATCCAGGGACCCAGGCTCCTTCAGTCCTTCATCTGTAAGGTCCCAGGT
GGCTCCACCACCTCTGTGTTCCAAACAGCAAGACAGAGGAAGAAGGAGAAGGGCAGTTCT
CTATAAGGACACAACTCAGCAATTTCCCATCTCTTCTGCTCACATCTTTTTGGCCAGACC
TTAGTCACATAAGCACACCTAGCTGCAAGAGAAACTTGAAATGTAATTTCTATTCTGGGC
AGCTACATGCTAAGCGAAAATTCTCTTACTGTGGAAGAGGAGGAGAACACTATCCGGAAC
CAACTGATTTTCTGCCAAAAGAACATTTTACACAGAGTTTCCAAAAGGCTGAAGGCAAAG
GCCCCGAGGAAGGAAAGTACTTGACTTGTTAAAGAGAAAAAACTGCCCCCTGGAGGCGTT
GCAGATGTGGCTGCTGTGTCACATTTGTGTCATTAGGTGGCAGCGATTAGAGAGGCTATG
TCTATGCTCACCGTTCTGCCCCGTGAAAGTTTGAATGTTTAATAGTCCGAAGCTCCTGTT
TTGGGGAATTGGCATCTGTTTTCCTTCCCTGGTATCTGGGNNNNNNNNNNTTAAGGTGTT
ATGTTCCATCTCCTGCTATATCACATGTGTTTTTGTTATTCATAAGAAGAGCTTAGCTAA
ATGTTCATTAAAAACAGTCATGAGGCAACTTAGCCAAAATGTCTCTCTTTTTTCTTCACT
TGGGATGAGTTTTAAGGAAGTGTGTGAGGCACCATGCCTGGCATATGGAGGCGTATTACT
CTTGTAAGAAAGTACCATTCACCCTCGGCCAGCAGGTACCATCTGTATGTTGAGGTCCAT
TAAGCCTATCCCTTGCCAAGATCTTTTAGACTTGGACAGCCAACTGCTCACTGATTACCT
TCCCTGGAATGAACACCAGGCATCTACAACCCAGCAGGTCCAGAGTATCTCCTTCTACCC
ACACTGGTCCTCCTGTCATGCTCAGTGAACAACCTGTGGTTCACCAGGCAACCTGGCCAG
ACTTCCAAGCCGCATCCTTCATCATTTTTTCTTCTTAAGATCACAAATATTTCCTGAGTG
TCAATATGCACCCGCACTGTGCTAGGCAGGCCCAGGACAGAGTACTAAACAAGGTCAAAG
TGGTCCTTGCCCTCATGGAGCTTATAGCCTTGGAGCCTTCTTCACTTTCGCCAAGACTGC
CAACCCTCTGCGCTGTTCTGCAGACAGTCCTCTTCTCTCTGACCTGACTGCTGCTTTCCT
GTTTTAAGCATCCATCATTTCTTGCCTTGATTGACTTAAGAGCTTCCTAATTATTTTTCT
GATTCCAAGCTCGCTTTTTAAAGCCATTTTCACACATCTGCCTAAAAACAATCTTATACC
ACTGCTGCTAAACATACTTCACGGGCTCCTTACTGTTCTTAGGATAAGGGCAAAACTCCT
CACTAAGTGGCTAAAAAGAAGGATTGGACAAAGGCCCGTAGGAGTTCTGGGAAGGAAGAC
ACTGTGTTGTCCCTTGAAACCTGAAGTCTTTTAGTATTCATTCAACATTGTTAACCAGGA
AACACTGGTTCTATTAATAAAAATAGCATATTCATTTATATCTAAAGTTAGGCATTGGCT
GTGTGCATGAACTATAAAAGCATCTTTTTAAAGCTGTGTGCTTCATACATGTATAAAAAT
TGAGTCTTGCTCTACATATGATATATTGTCATATTATAGATGTCGTTCCATGTCATTAAG
CATTCTTCTACCATATCATTTTAATGACTACAGAGTATTTATTTATTTACTTATTTAGAG
ATGGAGTCTCACTCTGTCGCCCAGGCTGGAGTGCAACGGCACAATCTCAGCTCACTGCAA
CCACCGCGTCCCAGGTTCAAGCGATTCTTTGCCTCAGCCTCCCGAGTAGCTGGGATTAAA
GGTATGCACCACCGTGCCTGGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTTGCCAT
GCTGGCCAGGCTGGTCTGGAATTCCTGACCTCAAGGGATGCGCCTGCCTTGGCCTCCCAA
AGTGCTGGCATTACAGGCATGAAGCCACCGTGTGTGGCCTCTTAATTATTTCTTAAATTT
GGTCTTTTCCAAAATAATATATGCACAAGTTTAAAAATCTAATAGTATCAAAAAGTTTAA
AAAAAAAAAAAGCAGTCTGTCTCACCTGTTCTCACTTCAGCCCTGATCCCCAGAAGCAAC
CACTTAAGAATATTTTAGCTCTTGCTTTTCCTAACGTATGTCTGTATGTCCGAACAGTGT
GCGTATGGCACTTTTTACTGATTTATTTACTTTATCTACTGACCTCCCATCTACTGAATT
CCCATTTGATGCAGTCAATCGTGCAGCAAATATATATTGTGCACCCACTATGTGCCAGGC
ACTGTTCCACGCATTAGGAATCCAGCAATGAGCAAGACAACAAGGTTACTGCATTCATGA
AACTTATAATCTAGGAGAAAGACAAGTAAAAAGCAAACAACGAAATAAAACGATTCCATA
TACTGCTATGTGCTATCAAGAAAATAAAAGAGTGACAGAGATTTAACCGCCTGACTTTCA
GTAGAGTGGTCAGAAACATTTCTCTAAGGCGATGTCAGAGTTGAGCCCCTAATTGATAAG
CAGGGCCTGCCATGTGAAGCTCTATGGGAAGTGCCGTGATAGGCATCAGCACATGTAACA
GAGACCCTCTTTAACAATGGCATAAGCAAGTAAGTCTATTGTTTGCCTCATGTAGTAGCC
TGAGGATAGGCCATCCAGGGACCCAGGCTCCTTCAGTCCTTCATCTGTAAGGTCCCAGGT
GGCTCCACCACCTCTGTGTTCCAAACAGCAAGACAGAGGAAGAAGGAGAAGGGCAGTTCT
CTATAAGGACACAACTCAGCAATTTCCCATCTCTTCTGCTCACATCTTTTTGGCCAGACC
TTAGTCACATAAGCACACCTAGCTGCAAGAGAAACTTGAAATGTAATTTCTATTCTGGGC
AGCTACATGCTAAGCGAAAATTCTCTTACTGTGGAAGAGGAGGAGAACACTATCCGGAAC
CAACTGATTTTCTGCCAAAAGAACATTTTACACAGAGTTTCCGAAAGGCTGAAGGCAAAG
GCCCCGAGGAAGGAAAGTACTTGACTTGTTAAAGAGAAAAAACTGCCCCTGGAGGCGTTG
CAGATGTGGCTGCTGTGTCACATTTGTGTCATTAGGTGGCAGCGATTAGAGAGGCTATGT
CTATGCTCAGCGTTCTGCCCCGTGAACGTTTGAATGTTTAATAGTCTGACGCTCCTGTTT
TGTGGACTTGGCATCTGTTTTCCTTCACTGGTATCTGGGAGAGTGGGTGGGCCTTGTGAG
TGGGCTTTCTGACCCTCACACTGGGCTGGGCTGGCCACTAGGGGTCTGAAGGGACAGTGG
GAAGGTAGAGGGTGCCTTCACCAGGAGCAGCCTTCATTAGTGAGTTTTAAGAGCCTGTGA
GAGGATGGATCAGGTCTGGCGTGTGCTGGTTCATGCTGCACACCGTGTCAGGATCACGAA
GGAAAGGACTGGGGAAGGGTTTGCTGGTGTCTCAGTTAATAGCAATAACGGCAGCCACTT
TATTGTGTTCTTGATTCTGTGCCAAGCATTCTTGTTATTTAAAAAAAGAGAGAGAGAGAA
GTCCAGGTCACTGAACAGAGGTTAAAGAAGGGGAGAGTGGGAGGATCTTAAATCAGGTAG
CAGATAGGACTGAACAATGTAGAGATTTTAAAACCAGGCTAAGGAATTTCCATGACAGAG
TTTTCAGCGGCTAACTGATTCGACCATTCTCTCTCATATCTACCTCTTTCCCATTCCTTA
ATAGCATTACAGCCTTAATTTTGACTAAATTATTAATCACTATTTACATGGTGGATCCAG
AACATCTGAGACAGGTCTCAGCTAATTCAGAAAGTTTTTTTTTTTTTTTTTTTTTGCCAC
GATTGAGGACATGGGCCCATGACACAGCCTCAAGAAGTGCTGACGACGTGTGCCCAAGGT
AGTCAGGGCACAGCTTGGTTTTACACATTTTAGGGAAGCAGGAGACATCAATCAATATAC
GTAAGAAGTACATTGGTTCAGTCTGGAAAGGCAGGACAACTTGAAGCAAAGGCAGGAAGA
CTCAAAGCAGGGAGGGGCCTTCTAGGTCACAGATAGGTAGAGACAAATGATTGCATTCTT
TTGAGTTTCTGATGAGCCTTTCCAAAGGAGGCAATCAGATATGCATCTATCTCAGTGAGC
AGAGGAATGACTTTGAATAGAATGGGAGGCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved