Pan_troglodytes Locus Poly:18:SNORD58
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:18:SNORD58
Pan_troglodytes
Poly:18:SNORD58
18
SNORD58, SNORD58
1001..1066, 3412..3475
4475
AGCCTGTCCTAGAACTACAACCCTGTTTTTAATTGACTGACATTTAAAACCCTGAATTT
TTATTTCTGTATACAAAAAAGAGAACTTTGAGACAGTCCCTAAGGAGGCAATTCGTTTTC
ACACGTTCTTAAAACATATTCCACACTCCCTTCGCTTTCCGCCTTCCTGCCTCCTCAGAT
CTCGTTTCTTCGGCTACGAATCTCGCGAGAAGTCAAGTTCTCATGAGTTCTCCCAAAATC
CACCGCTCTTCCTCTTTCCCTAAGCAGCCTGAGGTGAGTGTTTCTCCTGCGTTGCTCCGA
GGGCTCAATCCTCCTGCCATCGCCGCCATCCTGGCTTCGGGGGCGCCGGCCTCCAGGCCC
CCGGGAGGAGAACTCCTAGCGCTACTAAATCCTCGCTGGAGGCGGTGGTTTCTTATGCGG
GAGGACGTGGCGGAGGGCCTGACTTTGGGAGCCGGGGTCAGTCGGCCTCTGAGGTCCGCA
GAGGGACGTGATGGGCGGCAATGGGGACGACCGGGCTCCTCCACTGGTGGAGGCGCCGGC
CCGCCGTGGGGTGCGGGCCGCCTGTGGTCCGTGCGGACTCCGGAGGTCCGGTGTCTAGTG
GTGAGTGGTGGCCGCAACGAGGAAAACGTTTTGGGGGAAAGAAAAGTCGGGTGGAGGCGT
TACACGTTACTACAAGAGTGTTGCGTACTGGAGGGCTCTTAACGTGGGTCATAGCCCGAA
GGTGTTGAGAGAGACGGCACTCACTACCTGCAGCCCTGACAGCAAAGGGGTTTCTGTAGA
GCGGGAGGGAGGAGGTGTAGAGGGTTATAGTTGAGTTGTGCCATGTGGATGCGTCGAGTC
ATTTTACGCCTGGAAGATCCAGCATTGGATTGAAACAGGCTGTATTTTCTTCCAAAGGGT
TGACTGGATTGGTGAGGCCCATGTGGCTACTTCTGTGGAAGCAGTGCTGTAGTTACTGGC
AGATAAAAGGGAAAGCAAGCCCTTGGTGGGGGAAAGTATGGCTGCGATGATGGCATTTCT
TAGGACACCTTTGGATTAATAATGAAAACAACTACTCTCTGAGCAGCTGTTCGAATCATC
TGATATTTATACTGAATGAGTTACTGTAAGTACGTATTGACAGAATTACACTGTACTTTC
CTCTAGGTAATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATG
TAAGTGGACAGGAGGTAGATACCTATTTCCTACTTGGGGGTTGGCATAAGATACCAAAAA
TTAACCAAAACGTTTTATTTTCTAGCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCAC
TTCAAGGTATGCGATTCATAGTTGTGATCCAACAGTTCCTCATGTTCCACTCAAAAAAGG
TAGCTGCAGTGATGACTTTCTTAGGTCACCTTTGGATTTACCGTGAAAATTAATAAATTC
TGAGCAGCCACCTTATATTTAGGCATTGATGATCAGGGTGTAAGGATGTAGCGTTTGTAC
CAGAAAACCATTTGGAAATCTAGTGTGCAGATCAAGATGGAGCATTTTAATTGTAATTAC
ATGGTGATGGAATTTAAACATTTTATAGTGAATAAATGGAGTTTTGGAGTTTTCTCTAGC
TTCAACGAAGTTTACCTGGCTTTTAGTCACAAGTTTTTTTAATTGCCTTGCCCCCAAAGA
ATAGAAATAACTCGACATTTTGAAAAGCTGAAAATTTAATGTTTACTTTAAAAATTAAAG
CTTTGATCTAGTTAACCAACACTTTATTCTTCATACTTAGAACACTCGTGAAACTGCTCA
GGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACA
GAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGTGAG
AATTCTTAGTTGCCATTTGAAAAGACAGATTTTAATGGAAAAGTGATGGGATAGGATAAG
AATGGCTAAGATCTGTGCTGATGAACCTATTTCTGGTTGCTGTAATGACAGGACACCGTG
GATTGATGGTGAAATAAACCATATCCTAAGAAACCTTGATATCAGATAAAATAAATTCAT
CTTGGCTGTAACGTTAATTTAAATCAAGGAAAATGACTCATCATCTCCATTTTCTTTCAG
GCCAAGCAGTGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTG
CACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGTACCCAAACCATTAACATCC
TGTGCAACTTGGGTGGTTGTTTAATTAATGTTGGCTGTTCAGATTTATGTCCTTGATTTT
CTTGTTTTCAGTAATTAACTCATTTAGGATTTTTTAAATTTCTACCTGCAGTTTCCACAG
AATGAAACTATTTCCTTTTATTTTCTTTTGAGTCCCTTTATGGCAAAATTCTGTGAAGAT
CCAGAAGCGTGCTCTGTGGTCTCTTTAAGCCTAACACTTAGTATTTCTAGTTTTCTGCTG
TCTTTTTAACACTGGAGGTACTTTACCAGGGGCTTTTACCCCTTTTTGTGACATACACCT
TTGATAGTATGATTAATTATCAAAATGATTGCCTTAGCAGTGATTAATGTGGTTTGTGGC
CTACCTTCATAATGGAGAGTCATGTTGCATTTCAGAAAGAAATTGTTTAAAATTTCAAAA
AGTTTAAACAATGACAAACTTGTGTTGACAAAACACAAATTTCTCCATTTTGTATATTAC
CCATTAGCCTTTTGCATTTGAAGGTCTGGGCCAGAACTGGAATTAGTTTAGGTCTGTATG
GCTCCAAACCTTCTAAGCCATGCTGAGAAATTTTGTTTATCATCAAGACTTCGAATTAGG
TTCTTCCTTACCCCTCAGCTCTCCACCCGTCTAAGGATCTTTGGGAAGGCCACTCATAGA
CAAAATGTATAGCACACTGAGTTTGGTGGCAATTTAGACATGTAAAGGTGAAGGCAGACA
ACTGCTTTAAAAAATGCTATTTGCAGAATAAAAGGATTGCCTTTCAAAAATGATTTCATT
GAGGCAGGACTTTGGAGCAAGCCTGGGAATTCATATTTAGCAATGATAGTTTGTGGTGTT
TTACTAATTAAGGATGTTCCTGGTTTCATGCTCTTTCCTTTCTTCCCCAGGGTTTAGATG
TAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGA
CTTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGA
TCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAA
AGGTAAATAAGTAGTTGCTCGGTTTTGTTTGTGATAGTAGAAAGATTTGTGGTTGCTGTG
ATGACTATCTTAGGACACCTTTGGAATAACTATGAAAGAAAACTATTCTGAGCAACCCTT
TCACCTGTCTTATTTTGGCTTTTGTAAGTTTGTTTCTTGACTAATAATAAATGGTAAGTT
TTCTGTAATCCCAGCACTTCGGGAGGCTGAGGTGGGTGGATCACAAGGTCAGGAGATCGA
GACCATCCTGGCTAACACAGTGAAACCCCGTCTCTACTAAAAATGCAAAAAAAATTAGCT
GGGCATTGTGGCGGGTGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGC
GTGAACCCGGGAGGAGGCACTTGGAGTGAGCCGAGATCGTGCCACTGCACTCCAGCCTGG
GTGACAGAGTGAGACGCTGTCTCAAAAAAAAAAAAAATGGTAGTTTTATATTCAATACCT
CAGGCCCGTATGATTATCTGCTGATGGCCCCACTTAGATGTACATAGCCACTTCAAAATG
GGCCCTCTCCCCAAATCTAAGAAGCTTGTTTTCAGTAATTGATCACATTTAGTTCTTTTA
AGTCAAGAACCTGAGTGATTCTGTACACTTCTTTTTACATCTAATGAACTTAAGTTCTGT
TGATTTCTACCATTTAAGTATTTTTCCCCCTTAGTCCTTAACGACTAGGTTTCCTGCCTC
CAAAATAAGCTGAAGTCTTCCAAGATGTACTGTGGTTTTCTCCAAGAAACTTAACAACAC
ATTTTTCTTTCCCCAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGA
GTAAATTCAGCATTAAAATAAATGTAATTAAAAGGAAAAGAATGTTGGTTGTCTTTATTA
GTGAACATATTTCAAGTGTCCTTACAAGATGGATCAAATGAGGATTTTTTAGCATTAGAA
CTAGAAACACAGATTGTTTACCCTGCACCATTAAAAACCATTTTCATGGCTGGGCACAGT
GGCTCATTTCTATAGTCCCCAGTACTTTGGGAGGTGGAGGCTAACTGCTTGAGCCCAGGA
GTTCAAGCCCAGCCGGGGCAACATGTCAGAACCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved