Pan_troglodytes Locus Mono:279:SNORD45
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:279:SNORD45
Pan_troglodytes
Mono:279:SNORD45
5
SNORD45
1001..1077
2077
CTGGAACGTAGATAACGTTGTTGCCTGTGAAGTTACAAGAGTTGGAGCACCCAAAGGAA
ATGCATTTTTACTGGAAGCTGCTGTGGTACCTACTCCAGATGAGAAGTTAGCATGAATTG
ATTTGGTGCTGGCAGGTGTTCTGATATGATTTTTAGGAATCAAGTCTTCCAGTTCCTTAG
CAGGATCTTGAATGAGTGCATTGATTAGTTGAACTGCATATCTTGTTGATTCTGTGCCAC
CCCTGAGGGAAAAAAAAAACAGAAACAAGACCAAAAACATTAAAAAAAAAAAAAAAAAAA
GGTAATCTTAACCATCAAATAAAGTTCTTAATTATATCATACCTAACAAAGGTATGCTTC
TTATAATTTCTACTCAGAACTAGCAGTATACATTTTGCACAATTACCTTATTGTGATCAT
TCTCTCGCCATTCTTATCTTTTTGTTTATCCACATCAATATGGGCACCAGTAACATCCTG
TATTGCAGTGATGTTGCATCCACCTCTTCCCATTATCCTGGACACCACTGAGGCTGGAAC
AGACAATTTCTTTGACCTATAAAATGAAGAATACACATGAGCTTATGAAATTAAATGTCT
CTTTATTAAAAAAGATGTCTTAGTAAGTATGTTCATGGACATTTTGTAGAATAACATTTC
TTAAATGCTAAAGAGGAAATTATTAAAAGTTTTTATTTTAGAAACTGATCTCTTGTAATA
TTGAATTGAATTTAGTAAAGTTAAAAATTACATTGCCTCTGCAGTTTCAGAGAACCTAAT
TTTAAAAATTACACTGCCACTGAAAACAAAAATTATATTTAAATCACTCACAATATAAGC
ATTCAAATCTGCCCAAAATATTACACATCAATTAAACTGCAATGACCCTGTTAAAATAAT
GAATACCATATTATTAAAATCCACACAGAATAACTATGCTAGCATATTCATTTTAAACCA
GTATCAACAGCTCATACTTAGCAATAAAAAATAAAGCCTCAGGTCAATGATGAGCTGACA
TGTATTCTGAATCTAAAGTTGATTATTAGTACTTTAGTTCTAGAATTACTGAGACATGAG
AAAGAAAAAAAGCAAGAGAAAGCCTTTACATTTGAACTACATAAAAAGCAACTGAGGTTA
TCCAAAAAAGCCAAAATTTCTTGTGTCATATAAAATATGCATGCAAAATTTACATACTGC
TTCTAATTTTGCTTTAGCATATTCTGGATTTAGTGTGGCAATGCAGTTTAAAATAATAAC
CACATTCAAATTATTCATTAATTAACGAGGTAGCCATCTCACATGAGAAAGGGAAAATAT
ATGAAAGCTAAAAAGATGGAACTAATTCTATTTACCTTCGTACAACTTCTTTCCACCCTT
CTTCTCTTTTCTGACCCCTTTTAGGGCTAGTGAGATTCAGCTTTATGTTTGGAGAGCTTA
ATGGCAATGACACTGTCTTGTAGCTGGTTGACAAGGAATTAGGAGTCACTTCACCTTCAA
GTCTAAGAAGAGACAAATAGCAAGTACAATAAAAGATAAGTTTTAAGATAGAAACTCAAG
AGACTATTGCTTTATAGCCAGAGTTATGCTGAAATATTCGTATTAAACTTTGGCACATCA
AATAATCAATGAGTCAGAAAAACAGAAATAGAGCAAAGAACCCATCATTTATTTTAGTAT
TAAAATGGATTCAGATGCCAAAAATTAGACTATAATCAATAAAAATGACATAGTTAGATA
AAATCAAAGCATGCAAATATTTTCAACTTCAGACTATGAATCCTATAAAAATTTCTAATA
ATCTCATTTCCTAACTAGCAAATGATAAAGAGGACATGGGTGAATTTCAGTTTTGAATAT
TGAAGACAGATAATGTGGTAGACTTCAATTGTTTAACACAACTTGTACTTGGATTAATAT
ACTTCAAATTATTGTGCCAGGCATGAAGAAGGAAAGATGCAGGTAGAGTTAACAAATCAG
AAAAATTTACCGTGTCTGAGTTCTGGAAGTAGCAGTACTTGTCTTTTCTTCTTGGGAATG
AAGGAGCAGTGAGGGGTATTTAGAGGAATTCACATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved