Pan_troglodytes Locus Mono:141:SNORD55
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:141:SNORD55
Pan_troglodytes
Mono:141:SNORD55
9
SNORD55
1001..1076
2076
ATAGAGGGGAACAAGTCACACTTGGACCTATTGGAGGATGGAGGGTATGCGAAAATAGA
GGATCAGGAAAAATAACTAATGAATACTAGCTTAATACCGGTGTGATGAAATAATCTGTA
CAACAAACCCCCGTGATACAAGTTTACCTATGTAACAAACCTACCCGTGTACTTCTGAAG
TTAAAAGTAAAAAATAAAAGGAATTATAAGAAATATTTAACACAAAAAAGATTTTTAAAA
ATGGGTGAAATGCCCCAATTAAGAGGCACATAGTGGCAAGCTGGATTAGGAACCAAGACT
CATTGGTACGTTGTCTTCAAGAGACCCATCTCACATGCAGTGAGACCCATAGGCCCAAAA
TAAAGGGCCAGAGAAAAATCTACCAAGCAAACAGAAAACAGAAAAATCCTAATTTCAGAC
AAAAGAGACTTTAAACCAGCAAAGATTACAAAAAGGATATCACATAATGGTAAAGGCTTC
AATTCAAAAGAAGACGTAACTAATCTAAATATATATGCACCCAACAGAGGGGCATCCAGA
TTCATAAAGCAAGTTCTTAGAGACCTGTGAAGAGACTTAGATAACCACAAAATAATAGTG
AGAGACTTCAACACCACACTGACAATATTAGACAGATCATCAAGGCAGAAAATTAACAAG
GATATTCAGGACCTGAACTCAGCACTGGACCAGATGTACCTGATAGACATCTGCAGACAT
CTTCATCCAAAAGCAACAGAGTATACATTATTCTCACTGCCACATGGTACATACTCTAAA
ATCAATGACATAATCGGACACAAAACATTCCTCACCAAATGCTGTATAATGAGTACTAGG
CTCATTATAATAACCACCCTCTCAGACCACACCACAATCAAATTAGAAAACCAGACTAAG
AAATCCACTTAAAACCATATATTTAAATGGAAATAGAATAACCTACTCCTGAATGACTTT
TGGGTAAATAGTAAAATTAAGGCAGAAATCAAGTTCTTTGAAACTATTGAGAACAAAGAT
GCAACGTACCACTCGAGTGTGCAGTGGGGAAGCCAACCTTGGACAGCTGAGCATGTGAGA
AAAAAAAAAAAGATGCAACATACCAGAATCTGTGGGACACAGCTAAGGCAGTGTTAAGCA
GGAAATTTATAGCACTAAATGCTCACATCAAAAGTTAGAAATACCTCAGTTTAACAACCT
GACATCACAACCAAAAGGACTAGAGAACCAATAGCAAACAATCCTCAAAGTTAGCAGAAG
ACAAGAAATACCCAAAATCAGAGCTGAACTGAGATTGAGACATGAAAAAAAACATTCAAA
AGATCAATGAATTCGGGAGTGGGTTTTTGAAAAAATTACTAAAATAGGTAGACTGCTAGC
TAGACTAATAAGAAAAACTAGAAGATCCAAATAAACACAATTAGAAATGTCAAAGAGGAT
ATTACTGCTGACCCTACAGAAATAGAGGTAACCATCAGAGAACATTATGCACATAAACTA
GAAAATCTCAAAGAAATGGATAAATTCCTGGAGACATACATCCTCCCAAGACTGAGCCAA
GAAGAAATTGAATCCCCGAACAGACCAATAATGAGCTCCAAAATTGAATTAGTAATAAAT
AGCCTACCAACCAAACAGAACTAGAGCCAAATTCTACCATATGTACAAAGAAGAGCTAAT
ACCATTCCTACTGAAACTATTCCAAAAATTGAGGAGGGACTCCTCCCTAACTCATCCTAT
GAGGCCAACATCATTCTGATAACAAAACCTGGCAGAGACACAACAACAACAAAAAAACTT
GAGGCCAGTATCCTTGATGAATATCAGTGCAAAAATCCTCAACAAAATACTGGTAAACCA
AATCCAGCAGCACATCAAAAAGCTTATCCACCACAATCAAGTAGGCTTTATCCCTGGTAT
ACAAGTTGGTTCAACATACACAAATCAATAAATGTGATTCATCACATAAATGGAGCTAAA
GACAAAAACCATATGATTATCTCAGTAGATACAGAAAAGGCTTTTGATAAAATTCAACAC
CCCTGCATGTTAAAATCTTTCAATAAACTAGGTATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved