Pan_troglodytes Locus Poly:22:SNORD115
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:22:SNORD115
Pan_troglodytes
Poly:22:SNORD115
15
SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 3080..3153, 4957..5042, 6272..6347
7347
ACACACACATGAAACATTCAGCAGAATAGACCACATTCTGGGCTAGAAAATGCACCTCA
ACAAATTTAAAAGAATAGAAATCATACAAAGTATGTTCTCAGACTACAATGGAATGAAAG
TAAAAAAAAATCACTAAAAAAAAAAGATAGCTGAAAAACATGAAAATACTTGGAGGTTAA
ACAGCAGACTCTGAAATAACTGAAGGTCACAGAAGTCTCAAGATAAATTTTTAAAATATT
TCAAACTAAATGGAATTGAAAGCACAACTTATCAAAAATTTAGGAACGCAACAAAGGCAG
TGCCTACTGGGAAATTTATACCACTGAATGTATGTTAAAAAGAACAAAGATCTAAATAAA
TAATCCTTCCCATTGGAAAGCTAGGGGGAAAATTCAAATTAAATTCAAAGTAAGCAAGTG
AAAGAAATAATAAAATACGAATACAATTCTGAGTGGCCTGATATCTGATTTCTGGAAGCT
GAGTTTTATGTGGCTTTAGAAGTTTCATGTTATGAGTGTGAAATGGCAAGTGACCATGGC
GATTGTTTCTGATATGGCCACCTCAATTACATAGAGAAGGGATGATCAGTGGCATCATCC
CAGTTCTGCATGATCCCACACCAGTGATTCTCCAAAGTCAAGAAACCTGTATATGTTGTC
CTTGTGTTTGGTGAATCTGTGGTCTATAGACTACATAATGGGCTATTTCTGGGGTACTGA
CCATTTTGCTCCATTAAGGAAAACCATGCATGAGCCATATAACTATGGGAAATAATGTTT
TCCTTTTTGACACCTGGCCTACTCTCTTCTTAGGTGAGAGCAAAGGAAGAGCACCACTTG
GCCTGCTGCACCCAGGGCAATTTATACCATCCAGATATCCAGCACTGAATATGTAGCAAC
TCCAATCCACCATAGAACATTAATCTATCTCTGATAAGCATGCTAATATCTATGATTCTG
CCTTTGTGGGGAGATGACTCCATAGATTAACCCCCTGGCTTGGGGCAATATGGAGATGTT
ATATTGTCTTCGACAGGGAAGATGACATAAAAATTATGTTCAATAGGATTATGTGGAGAC
TTAACATAAGTGACAAACCTGAGACAAGAAGTTAGAAATCCTTGTTTCTTTTAGGTGAAT
AATTTTGGAGCTTGAGAAAAAGACACCATTGTGGCGAACTTGCTTTGCCAAACCCTGTGT
ATGCATTTTTGGGTAAACAACACATTTTCATCCTTTAAGCATTGTTTCCATTATTTATAA
TTCCTAATAGTATGAGACATTTAGGACTCATTCCTTGGTTCTTCTTCTCTCATTGTATCT
TTCATTGTATCTTTCAGTGCTGCAAGAGATGCAATCATCCCATTAATGAAAGCAGAGTGA
CTGCCTTCGTCACACATACATTCAAAATAGATCACTTGGCTAGTGATGATTCTCTCTTAA
GGCTATTATGTTTACTCATTTAAAAAATCTGGATCTCAGTATAGATTTTCTTCTCAGTGA
GTGACTGACCTATCTGATATGATGCTATGACAAAATCTTTACTTTTTACCTGAATTTGGT
GGGATTGAAAGTTGAGAACATATTAATTTATTTTCTGTTTCACTTGATTAATAATGCCCA
ATCTAACATGCAGTGTTCACTTGGGTACATATATACAACTACATCAAATTTTTTCTTGTT
TTACCTTAAAAGTGTTAAGATATTGTAATGGTATGGCCAGTTTACTCACTGGTAAACTTT
TCATAACAGAAATATCATGCCAGTGGACACAAATATGTAACATCAGTAATTTGCTTTCCT
CATGAAACAGAGAACTGAATAAGTTGATGGGTAAACTAGTATCTGAATTATAAACCCCAA
ATATCATGTGACTTCATCATTTTCAGTATAATGAAAATACAGGCTGTGAATGCTTCCAAT
TGGTCCTGAAAGGGCCTTTGAGGTGAGTAGGTTCACCAAAGCGGCAACATATGTGTCCCA
GTGGGCATTCTACTCCTCAGTAAGTGACTTGACATTCTTTATGGCTTCCTCATGATTAAA
ACAAGTCTTTTTATTGAAATTTTACTGAAATAATGATGAAACAATGTAATATTCTTTTCA
TCTACATATAAGAGTAGACATAGATTAACCTCTACCTTTTTTTTTTTTTTTTGAGACGGA
GTCTCGCTCTGTTGCCCAGGCTAGAGTACAGTGGCGCGATCTCAGCTCATTGCAACCTCT
GCCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCA
CGTGCTACCATTCCTGGCTAATTTTTTTGTAATTTTAGTAGAGATGTGGTTTCGCCATGT
TGGTCAGGCTGTTCTTGAACTCCTGACCTTGTGATCTGCCCACCTCTGCCTCCCAAAGTG
CTGGGATTACAGGCTTGAGCCCCCGTGCCTGGCCTTCACCTCTACCTATTATAATATTTT
CATGTTATTCCATTTTGTCATGTTTGTGGGTCATTTGATGAGGGTTCACAATATGAAAAC
TGGGCATTTTGGCCAAGATGCATGTAAATGAATATAACTCCATGTGCCCTGATAACTGAT
TTCTAGATCCTGAGATGCAAGTGGCTTCCAGAGTGTCTGTATTTTATGAAAGTTCATATA
CAGTAAACCATGCTAATTGTTACTGATACAGCTTCCTTGAATATATAAAGCGATGATTAA
TGGGATGTTTTGTTTCTGCATAAAACCACTGAATTGCTTCTCCAAAGCCAAGTGACCTGT
ATGATTTGTCCTTATTATAGTTTGTGAACCAGTGGACTAAAACCTTTATAATGGGTCATT
TTTTTAGTATTGTCAATATTGCTCAATTAACAAACATGACTCATATACACAGGTGAGATG
TAGTTCTCCCTTTGACATTTGCTCTACTTCTGTCCCTTAGATGATGATATGGAAGAAAAG
CACTCTTTGGCCTGTTGTGACTGGGACAGTTGACAGCACCCAGGTGTCCTTTAATGAAAA
TGCTCTTGACACCAATGCATCCTAGCATCACAGCTTCAGGAAGCCTTCTCAAGTGTGCAT
GGGGAGTACCATGTCTTTCATCAATAATGAAATCTTCTGATGTCTTGGTGAGAAATAATG
CCTTAAAATTACACTCAATAGGATTATGCTGAGGCTCAGCCTACCTAGATGAAAATGCTG
AAACAGATAATAGTGACTTCTTATTTCCCTTCAAGGGGAATTTTATTTTGAACTTGAAAT
AACAAAATCTTTATGGGTAACTTGTTTGCCCAACTGTATCAGTGCACCTATAAATGAACA
AAAAATTCTCAGCCTATAAGCTTTGCTTCAGTGATCTTTAATTTCTAATAGTAAGGTATA
TTCAGGTCTCATTCTTTGGCTTTTTCTCTTATTGGGTATTTCAGTAAGACATGCTGCCAA
GAGATGTGCCATTCTATTATAAAAGATCAGTAGCTTCCTTTACCGACGTGTATATTCTAT
CTAGAACATTGAGCTAGGGAAGACTCCCACCTAAGGGAATTAGTTTTACACCTTCAGGTA
ATCTGAACTTCAATATGAGTTTTGCTTTATGATATAATCCTTATGACAAAATCTTTACTT
TTTATCTGAACTTCATACAATCAATATTGAAGATTTTTTAAATTCACTGTTACCTAGTCC
AATATTTAATATACATTTGGCTATAGATACATGACTAGACAAAAATTTTTTATATTATTA
TTGTGGGGGCTCTAACAGTGTTTCACTGTTTTGAGTTACTGATGAACTTTCTGTAACTGT
GAGACCATGGTAATGGAAGAGACCGTGGTAATGGGGAGGAGAATGTGAGGATCAGTATGT
ACTTTGCCTATAAAACTTAAATATTTAGTAATTTGATCACCAAATTGATACTCAAATTTC
AGTTCCTATCATGTGTAAACCAAAAAGTATCTGAGATTTAGAAGTTTATTTAGAAGTGGA
TTTTGCCAAGGTTAAGCACATGCTCAGAAGAAATAAACCCAAAATCACAGAAACCATCTG
GGGTCTATGTCTTTCTCCAAAGATGATTTTGAGGGCTTCAGTGTTTAAAGGGGAAAAGTG
GGCTGGAGGGGGAAAAGGGAGGGTATGATAATCCGTACGTTCCAAGACAAAAGGAGCAGG
TAGGGGTATAGTCAATAATGTATTCATCTCATGCTCAGTAAATCAGCACTTTACATAAGA
TAAGGTGAACATAGAGAAGCTACCTATGGAGATCTTTAACCTTTAATCTGTAGCTATCTG
CTTAAGATCAAAAGGAAATTCTTGCATGACTCAGCTTTCAGCTTATTTTTTTTTCTTTTG
GCGTAGTAAATTGGGGTCCCAAGTTTATTTTCCTTTCACACATGTGACCCCACTATTTTC
AGAATAATGAAAGCACATGTTAGAAATGATGACACTTATTCCTAATACGGACTTTGAAAT
GACTGGGTTCACAAATTTAGAATCATGGGTCTCACTGCAGGTTTTTATTTTCAATGAGTG
ACTGGCCTACTTGATGGAATTCTTTCAAAAAATGTTCACTTTTTACTGAAATTATATTAA
AATAATGTTGGAATATGTTCAGTCATGTTTACCATCTCTATAGTATGATATATGATAATA
TCACAGATTACTCAGTGTCAAAAACCTGGCATACCTTGTCCTTATGATGTTGATGAGTCA
ATGGTCTAGAGCCTTAGTAATATGTCTTTTTGTGGTAGTATGGACCATATCTGTCCACTA
AGAAATAGCCTGTGTAAGCCATATACACATGAACAATTTATGTCTGATTTTGAACTATGG
TCCCATTCCTATGCCTGTAGATAAAGACTGCTGAGAAGAGCACCCTCTGGTGTTGTCACA
GAGGCAAGTGCTACCGCACAGGCATGCTGCAGTGAATTTAACTGATCCTCTGTCCCTGCA
ACCGTTGTTTAAGGATGCTATTCTGGTAAGGGTTTACAAGACAACGTAAATATATGTATA
AAGAGTATCTTCAGGAGACGTAATAATGTAAAAATCATGCTCAATAGAATTAAGCTGAGG
CTCAAAATAGTGCCAATCCTTGAAAGAAGGTGTGAGAAGTCATTAGATTTGGGGGGTATG
GGTTATTCCATTTTGAACTTGGTAGGAAGAAACCCTTGGGGGAATCTTACATCATTTGCC
TCTACCTACTTCTAAAGGAACTTTTAAAATTCTTTTATCTTGTCTTTATTCTTAATACTC
ATACATTATTAGAGAGAATATCTTGGTTTATTTTTTCCTCATGGTGTGCTTCAGAATGTT
CATCCAGCAAGAGGTGTGTCATTACACGGATTATATATATGAGTTCTGTCTTTCGTAATT
AAAAAATTTCAAGTGGACCATTTGAATATTAAACATTGGCCTTCAAAATGATTACATTTA
CCTGTTCATACAAAATTAGTGAGCAATGATCTATTCTTTCCAATGAGTGACTGATCTAAT
GGGGTCCTCATTAAAACTCCTTTTTTTTTTTTTTTTTTTTGCCTGAACGTACTTTGATTT
AAAGATGTGACATTTAGTAATTCATTGCAATCAACTCTTTAGTGATTGCACAAATAGACA
ATCCTTTTCTATTATTTTATTTTTTGGGTTGCTGTGTATGGTGTTATGATGTTTGTGGAT
CATTGGGCACTACTCACAACTGAAAGACTTTGGCAATTTTAGGGAATGGCTTGAGATTCA
GCTATAGGTTACCCTTGATTGAAATTGAATACAATACAGGTAGTCTGAAATCTCATTTCC
TTATCCTGAGTCTCACTCAGGTGTCATTAGATTCATTATAAAGAAATGCATACACTATGT
ATGATGCCAGTTGTTACTGATATGAAGACGATAAGAAGCTTTTATTTCTGCAGGGAAATA
ATCCCTTACCAGGTCATCAAAAGACATGATACCTATGTGCTTGGCCCTTACTGTACACGG
GGAATCAGTGGTCTACCACAGCTTAAGTAACGGGTCATATTTGGAGTATCACACATCTCA
GTCTTGTAGAAATTAGGAACAGCAATTAGGAGTCATGCACATATAAGAGATGTAATCCCA
CCCTTTGACTATAGCCTACTCTTGTCTTTTACAGAAAAGACTGTGGAGGAAGAAAACCCT
TTACCCTGTTGTTCAGGGAGAAACTGACACCACTCAACTGCCTGGCACTGAAAATGTGGC
ATCCAGTCCACTTAACCATCAGTGTTTAAGGAAACCATCTCTGGTAAGCATATTTGATCC
AAGTGTGCATATGCACATGAGTGCCATGGGCTGGGTCAATGATGAGATGTTACCTTGAAG
AGAAATGATGACGTAAAAATTAAGTTCAGTTGGATTACGCTGAGGCCCAGCCTAGGTAAC
AATTGTGAGACAAGAAGTTTGGATTTCTTAGTTTCCCTCCATTGGGGGACTTTATTTTGG
GATTCTAGCAATGGAATCTTACTGCCGAAACTTGTTTTGCACGCTTCTATCTGTGTGCTT
CAAAGAAACTATAAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGNTATTTA
AGTTTNNTATAAGTNGTAATTTTGTTGGATATTTGGNANTAATATNNTTGGTNTTTTTNT
NTNATTGGATGATTTAGTAAGTGGTAGTGGNANTATTNTATTGAGTGGAGGTGAGAGGNT
GNTTTTGNTGANTGAAAAATTTNAAATAGATAATTGAANTAGTGAAGAATGAGNTNTATA
ATAATTAGATTTATTNATTNAGAAAANATGAATATNANGATAGGGTTTTCTTNTNAATGA
TTGANTGANANATGTGATGNAATTTGTATGAGAAAATNNTTANTTTTGNNTTANGATTGA
TTGTTTTCAGGGTTGAGAAATATGATACATTGGAATTTTGCTCAATGCGCTACAGTTATC
GTGGTCTAAATATACAGACAAAATTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved