Pan_troglodytes Locus Mono:246:SNORA75
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:246:SNORA75
Pan_troglodytes
Mono:246:SNORA75
16
SNORA75
1001..1124
2124
TTGGGTGAAGTTTGAGGACTGCAAACCAGAGTCATGGATTCACGCTGCCCTGCATATAT
GCTCCGGAACAGATACTTCAGAAAACTCCATCAGCCAAATGAAAAACAAGCTTTAGAAAA
ACCACACATGGCAGGAGGGGACTGAGAGGGAGCAGGCAAACATCCAAAAGAGACCAGAGA
AAATATGATATATATGGAGAGGGAAAAAGGAGAGCTAATGAACAGATAGTTGATGTTCTC
AAAGACAGAAAAGAGAACAAATAAAACAGAAAAAAAAATTTTTTAAGGAAGGTGATTTTC
TATAAATGAAGATATGAATTGGTAGGTGAAAAGGGCTGACGCTGGGTCCTGGAAAAGTTA
AAAATTTTCAAAACTGAAAAAGAACCTAGAGAAGTTACTAAACTACAAGGTAAAAGAATC
TTATAAGCCATAATTTGGCAAACTATGCACCAGCAGGCCAAACTGCCATCTGTTTTTGTA
AATAAAGTTTTACTTGGCCAGGCATGGTGGCTCGCGCCTCTAATCCCAACACTTTGGGAG
GCCGAGGTGGGCAGATCACTTGAGATCAGGAGTTCAAGACCAGCCTGGACGACATGGTGA
AACCTCATCTCTACTGAAAATATAAAAATTAGCCAGGTGTGGTGGCGCACGTCTGTAATC
CCAGCTACTTGGGAGACTGAGACAGGAGAATCGCTTGAGCCTGGGAGGCAGAGGCTGCAT
TGAGCTGAGGTCACGCCACTGCACTCCAGCATGGGGAACACAGCGAGACTTCGTCTTAAA
AAAACAAAAAAAATTTACTGGCACACAGCAAAGCCCATCCATTTACGAGTGGGCTTTTGT
GCCACAACTGCAGAGGTATCTGTGAGAGAGACCACAAGGCCGCCAAATACTAATATTTAT
GATCTGGCCCTTTACAGGAAATGTTTGTCAGTCCCTGTTATAACTATTCAGGGAAAAGAA
ACAAGCTACACACAAAAAAAAAATAATAGGAAGAAGCAGCAGGCCAATCTCATACTTATC
AGAATATAGAGGGAAATGCATTCGCACTAGAAGACAGAATTCACAGAAGTAGCATTTCAC
CTTTTGCCTTTACAGAAGTATATTTGGCTGTTTTGTGAGACATTCTGCGGGAAAAGAAAA
ATAAATATAGATGGCAGAAGACAATGAAGAATTCTGAAGGAGAAAGTGTGTGACCCAAGA
ATTCCAAAAGCAGTTATTGCTTTCTACACATAAAAGCAATAGAAAGACACTCCTGGCCGG
GCGCGGTGGCTCATGTCTGTTAATCCCAGCACTTTGGGAGGCCGAGGCGAGTGGATCACC
TGAGGTCAGGAGTTCGAGACCAGCCCGGCCAACATGGTGAAAGCCCGTTTCTATTCAAAA
TACAAAAATTACCTGGGTGTGGTGGCACACGCCTGTAATCCCAGCTACTCAGGAGGCTGA
GGCAGGAGAATCACTTGAACCCAGGAGGTGGAGGTTGCAGTAAGCCAAGATTGCGCCACT
ACACTCCAGCCTTGGTGACAGAGAAAGACTCCGTCTCAAAAAAAAAAAAAAAAAATTACA
GAGTTCCTTCTAATCTATATAATTCAATCACCATTAAGACATTCTAAAAACTGAAGACTT
ACAAGGCCTTATCTTTATAGAGAGATATACACAGAGATGAGAAGCAGCTAGCACTCACCT
ACAGACTGAGAGGTGAATGCCGCTACAATCTGCGGACTGGCTAGGGCCTCCAGCCTGTTC
TTCAGTGCCTCCAAGTGCACACACTTTTCTGAGTAGTCTGGTGTATCAACAAGCATCATT
AAGCTGTTCTGCATACCTGTTAGCTTGGCAGAAATCACAGCTATGTCCTAGAAAAGACCA
GAATAGAGAATATTTATTTTAAATGATCCCTACTGCCTCAATTGGGAATAGATAAAATAC
ATGAAAAGGCAACTCATCAAGTACGAAAATGGGGCTGGGCATCGTGGTGGTTCATGCCTG
TAATCCCAGCACTTTGGGAGATTGAGGCAGGAGGATCCCTTGAAGCCAGGAGTTCAAGAC
CAGCCTGGTTAACATGGCAAGATCCAGTCTCTACAAACAGCAAAAATTAGCTGAGTGTGG
TCATGCGCACCTGTAGTCCCAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved