Pan_troglodytes Locus Mono:72:SNORD65
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:72:SNORD65
Pan_troglodytes
Mono:72:SNORD65
7
SNORD65
1001..1071
2071
GATTTCTGCATCAATAAAACTCAATGACCTCGGGCCAAGTGCAGTGGCTGACACCTATA
ATCCCAGCACTTTGGGAGGCTGAGGTGGGAGGATAGCTTGAGCCCAGGAATTTGAGACCA
GCCTGGGCAATATGGCGATACCCCATCTCTACCCCCACCCCCCCAAAAAAGAAAAAAATT
AACTGAAAAACCAACTGGCCAGGCACAGTGGTTCACGCATGTAATCCCAGCATTTTGGGA
GGCTGAGGCAGGTGAAGCACTTGAGGTCAGGAGTTCGTGACCAGCCTGGCCAACATGGTA
AAACCCTGTCTTTACTAAAAATACAACAATTAGCTGGGCGTGGTGGCAGGTGCCTGTAAT
CCCAGCTACTCCAGAGGCTGAGGCAGGAGAACTGCTTGAACCTGGGAGGCAGAGGTTGCA
GTGAGCCGAGATCACATCACTGCACTCCAGCCTGGGAAACAGAGCGAGACTCCATCTCAA
AAAAAGAAGAAAATAACAAAAATACAAACCTCAATGACCCGAGACAACAAATTTATATCC
TATTTTCTTATACCCATCCCCCTACCCCACCCCTACACAAAAAAATCCAGTGAGTTTTTT
TTTTTTAACCCAATAACCCATTACAGAGTTGAAAAAATTCCCAACCAATACACTTTCAGT
GAGTGAATACTGACCAGCAAGTCCACACCAGCCATTGTTCTGGGTCTTTGATAAGATGGG
AGGACAGAGCCCTACCCACCTTAGCTCTGGTGGGAGAAATAGACACAAGTCAGAAGACAA
ATATAAAGTGCTGGCTTGGGGGTAGGGGACAGGGAGGGGTGCACACCTATAGCCCCAGCA
CTTTGGGAGGCAAAGGAGGGAGGATAACTTTAGCCTAGGAGTTTGATGCAGCAGTCAGCT
ATGATCTCACCACTGCACTGGGCAACAGAGAAGACTATGACTTTTGAAATATGTACTTAC
ACACACACACACACACACACACACACACACAATGCTAAGTCAAATAATGAAATCACCCAA
AATAGCTGGAATTACTGGCAGATTGTGTAGCAATAAATCTAGTTTTCTGAAGAAAAAAAA
AAATACATGAGAGAATGCAAGCCTACATGTTAAGCGCTACCATAGTGTTAAGTATGGGAG
AAATACAGGAGAGATGTCTAATCCAAGCGTGGTAGGAATGATGTCTAAATTGACGGCTAA
ATAATTGGTGAGAATCAAGAAAGATGGAAAGGATCCAGAACAAAATAAGACTGTTGGGGG
GAAAAAAAAGAGCAAATGGATTCTTGGCAAACAAAATGTATGCAAAAAGTCCTGAAGCTA
AGAGAAGGATGGGGTTGAGGAAGTAAAGTACTTCACAGTACTGGAGCACACAGCATGTGA
ATTTCAGCCAAAGGACAAATGCCTCCAAAAAAAGTTAATTCACAGTGCAGCAGGGCGAGG
CACTTGTCTTATTTGCTGGTTCTCACACTGACCCTGAAAGGACTTTTTTTTGTTAATCCC
ATTTTCACAGATGGGAAAGGGACTCTGTATGGTTGTCACTTTTATCCAAAGTCTCATAGC
CAGTAAGAAGCTGCCCTCAAAGTCCCTACCCCGTCTTTCCATTCGACCATTCTGGGGTTC
AGACCCAGAAACCCCATACCTCTGCCTTATATTTGAATAAAAAGTATGTCTCCAGGTTTA
TGTGGAGAATAACCAAGACCTCAGAAACATTTAGTGAAAATCAGAGCTAGAAGGAATCTG
TTTTTTTGCGAGTTCAGAGAAGCTGACTTGGATAAGACATCAAAGTTGTCTTGTGCAGCA
AATTCTCCTCTGGCACATAGTAGGCACTCTGATAAATTCAAAAAGGCTTCTAAGAAGAGG
CAGAAGCAAGGACAGGGAAGGAGCTCAGCTCCACAGCTCAGGGAGGGTGACAGAATGGCC
TAAGGCCCAGGAGAGCACCGTGTTGTCAACTGTCAGTGTCAAGCCTGAGACAGGAGCCAT
GAACTAGCACCATCTCGGCTCTGATGTTGAACTGCAGCCAAGGTCTCAAACTGGCCTTAT
ACCAACACATGCCTCCTTCTATCACCTAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved