Pan_troglodytes Locus Mono:123:SNORA25
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:123:SNORA25
Pan_troglodytes
Mono:123:SNORA25
8
SNORA25
1001..1104
2104
CCCAACAAATGGTACCAGAGTTAACAGAGAGGGCTTAATTATTCTTAAATAGAAAGATC
TAGATGTCATCTGATATCTTCAAGAATATTGTTTTGTGGCTTAATGGCAGGATAGGTGGT
AGTCCTTGAATCAGGAACCTGGGAAGCAGGATGTCTCTCTGCTCCTGAGCTGTCCTTGCT
CCTTGTGGCAAAGACTTGTTTCCATGAGAAAGCTGTGTGGATAGTGGGCTGAAGTTTCCA
GCCAAGAAAGTGACTATGTAAAACAACCCCATATTGTGACTCATTTCAACCGAGGGGCTA
GTAAGATCTCCAGCCAACAGATTCCATTATCAAGGTGATTATGAAACTGAATATCATGGT
GTGAAGGTTGGAGGAGAAAGAAGTTATTCTCCCCTGGAAAAACAATTTGCCTTTCATGGG
AAGCTCATAAACCAGTGGTGTTCATAGGCGGTTGTGGTTATCCTTGCCCCTCACCTAAGA
AATAGGATTGTCTTACTGGTTATTAATCAGCTAAAACATCATCTGCCATAAGAATTACAC
TGAAAAGGCATTTTCTGATAGTAGGTATCAAAGACTCTAAAATGAGTCTGCTAAATCTTA
TGATTCACTTCATTGATTCAGTTAACTTGTTTGTATCCTGTACATCTTGGATTTGATTCC
ATGTCTCATAATTGTCCTAAAATATAAAAATCTTGCCCATTATCTCCTCAGAATTATGTC
TTAATTCAGTTACACCACTTACACATCTACTAGGCCACTGAGTTTGCCCATAACTCACCT
ATGTACAGTATACCTAATTTTTCTCACTTGGATATTTTCTATTCTATCCTTAAGTTCAAT
AAATTCCTCTGCAATATCCAGCTTCTGCTATTCCCAACCACTGTAACTGTCATCCTAGAT
GTTGAGACTTCCTAAGTTTGATTTAGACATCTTCTACATTGTGCATGTTTTATTGAATGT
AAGACAGTGATAATGAAACACTCCTATAACCATATGCTCATAGGTCATTTTGTAGGGCTT
GTGGGGCTGTGAAACCAAGAGCTCTTAACGCTATGACCAAATATTGAAGTCTTCCACAGG
ATGTGATAGCCACCAGGAAACAAGACTTAGCCACTCACACTCATAACATGACTCATATCC
GTAGGAAAGTGCCTCAAAGTTTTAAGTGGTATAAAGTTATAACAACTAAGGTAACCAATT
AAATGTTCCTTGTGCCTGTATCTGTTAATCAACTTTTGTTCCTTCCCCTGGTGCATGTGG
AATACCAGTTCTTGTTGCATTCTCTTGGTTGAGTGTTGGTTTGGCCTCTTCCTCATCTCA
TAGAGTCAAACTAAAACAGTTCAAAGAAACCAAGGATTCTTTCTCCTCACTCACAAGCCT
CATTTGGAACTGCATTTCTATGGGTAAATATCTACTTAAATGGTGTGCAGTAGAACTTTG
GAGTCTGAGCAGCTTGCCTCTGTTAACTGATGATGCAACTATCCATCTTGTCTGACTTTG
ATTCCATTCCTTTTATGTCAATCATGGGGCACATTACCTTTCAGCATACTGTTTCCCAGG
TACAGTACCAGCTTGCTTTCATCTGGGCCTAGCCAGTGGGAGAAGCTTGCAGGAGACTGA
GGATGGGAGGGAGGGAAGTAATAACATGTTTCACCTCCTCACTGCCTCAGACCTCATTCT
GAGTCTGCTCCATGGGCCCAGCTTCATCAGACCGGACAACCACGGTGTCAGTCTCCAATG
GGAGACTATCCAGGTGTTTCAAAGACACCAGCTAACCTCATTTTCCAGTCAGCCTGGGAA
TGGTCACAAGTGTCTTCCCTCTTGGAAACCAAGCATGCTACTTTGCATTTCCATGGTCTC
TATTGTCAGGTTGTTACATCTTTCCTCAGGGAAGGGTGAGGGAGTGTTCAGCTTCCCATT
ACTTGTTTACATGAAATTCTTTTTGACACTTAGAATTCATGTGCCTTTTCCATCTTCATG
GCCAACTCTTGTATCCCCTGAGTAAAATTACAGGACAATGGTTTTCAGTTTACAAACACA
ACTCATTGTCATACTCAATATCCATAGGTTCACAGAACAAGCAGTGTTTTCAGTTTCAGA
GACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved