Pan_troglodytes Locus Poly:2:SNORA70
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:2:SNORA70
Pan_troglodytes
Poly:2:SNORA70
1
SNORA70, SNORA70
1001..1135, 2654..2788
3788
AGAGGCGTGTAACGTTTCTTACTCTGTTGGTGAATTTGTCCATTTTCCCTTGTGTTCTG
TTAATTTTTTTATTTTTTGATACAGGGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGG
CACGATCTCGCCTCACTTGAGCCTTGGTCTCCTGGGCTCAAGTGATCCTCCCACCTCTGA
CACCCAGGTGGCTGGAACCACATGTACGCACCCCCATGCCAAGCTAATATTTGAATTTTG
CTTAGAGACAGGTGTTCGCCACCTTGGCCACGCTGGTCTCAAGAATCCTGAGTTTTATTA
TATCCCCCTGCCACCGCCTCTCCAAGCGCCGGAAATATAGGCATGAACCACTGCCCTCGG
CCAATGTTTATTTTATTTGTTTGGAGACTGTATTATTGAACGGATAATACTCCAACATGT
GAGCTTGAACATTAACATTCAATTTGTACCTCGGTATTTGTGAACTACTTACCAATCCCG
GGTTCTGCCTCCCCGATTAGGAGTAATAATATCCTTGTCGACGCTTTATTTTCCTTATTC
TTTTTTTTCAGACAAAGTCNNNNNNNNNNTGCAGTGGTGTGATCTTGGCTCACTGCAACC
TCCACCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCATGAATAGCTGAGATTACAG
GCACCTGCCACTGCACCTGGGTAATTTTTGTATTTTTAGTAAAGATGGGGGTTCACCATG
TTGGCCAGGCTGGTCTCAAACTCCTGATCTCAGGTGATCCACCCGCCTCAGCCTCCCAAA
GTGCTGGGATTACAGGTGTGAACCACTGTGCCCAGCCTGGTATTGGTTTTTAAATTTTAA
ATTTCATTGTTCCTTACTATTAAATATAAATACTTGCTGGGTGCCGTGGATTTATATTAC
TTAACTGGTTTCCTTTGAAACTTTAATACAGATACTTAAGATCTCACATTTATCCCTACT
CTCCATCTGATAATACAAGGAGCTTAGAATGCTTTAACTTCCTGCAGCCAATTAAGCCGA
CTGAGTTCCTTTCCTCATGGGGGCCCAGTGTGCAATGGCTGTAAATAGCAGCTTCCTTGG
TAGTGTATGCAGCCTGTTTGTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGTCCTTT
CAGATGGCTGTTCATGTTTCCGACCTTACACTACCCCAATGTAGGCTCCAAACTGGCATG
CGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATG
TCCATCCACACCAAGCTGCAAACAAGGAGCATGTGATTGAGGCCTGCGCAGGGCCAAGTT
CAAGTTTCCTGGCCGCCAGAAGATCCACATCTCAAAAAATGGGGCTTCACCAAGTTCAAT
GCCAATTAATTTGAAGACATGGTGGCTGAGAAGCAGCTCATCCTAGATGGGTCAAGTACA
TTACCAATCATGGCCATCTGGATAAGTGGCGGGATCCTTGCACTCNNNNNNNNNNGGAGA
ATCACTTGAGCCCCCGAGATCAAGGCTGCAGTGAGCCAAGATTGTGCCACTGCACTCCAT
TTTGGGTGACAGAGCAAGATTCCATCTCTAAAAAAAAAAAAAAAAAAAAAAAAGGTATTC
CCTGATCTGTTAATTACTTTAATTACTGGGAGAGGCGTGTAACGTTTCTTACTCTGTTGG
TGAATTTGTCCATTTTCCCTTGTGTTCTGTTAATTTTTTTATTTTTTGATACAGGGTCTT
GCTCTGTTGCCCAGGCTGGAGTGCAGTGGCACGATCTCGGCTCACTGCAGCCTTGATCTC
CTGGGCTCAAGTGATCCTCCCACCTCAGCCTCCCAAGTAACTGGGACCACATGTATGCAC
CACCATGCCCAGCTAATTTTTGTATTTTTCTTAGAGACAGGGGTTCACCACGTTGGCCAG
GCTGGTCTCAAAATCCTGAGTTTAAGCAATCCACCTGCCTCGGCCTCTCAAAGTGCTGGG
ATTATAGGCATGAACCATTGCGCTCAGCCAATTTTTATTTTATTTGTTTGGAGACTGTAT
TATTAGACAGATAATACTCCAACATGTGAGCTAGAACATTAACAAGCAATTTATACCTAG
GTATTTGTGAACTACTTACCATCCCAGGTTTCTGCCTCCTCGATTTGAAGTAATAATATC
CTGTCTTACTCTTTCTTTTCCTTTTTTTTTTTTTTCAGACAAAGTCTCACTCTGTTGCCC
AGGCTGGAGTGCAGTGGCACAATCTCAGCTCACTGCAACCTCCGCCTCCCGGGTTCATGT
GATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACCGCCACCACACCCGGCTAATTT
TTATATTTTTAGTAAAGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGA
TCTCAGGTGATCTGCCCACATCAGCTTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACT
GTGCCCGGCCAAGTTTTTTGCTTTTTTTTTTTAAACTACATATTTCCCCATTTATTGGCT
TATGAGTTATATACTGTCTTCAATTTATATTACTTAAGTGGTTTCCTTTAAAACTTTAAT
ACAGATACTTAAGATCTCACATTTATCCCTACTCTCCATCTGATAATACAAGGAGCTTAG
AATGCTTTAACTTCCTGCAGCCAATTAAGCCGACTGAGTTCCTTTCCTCATGGGGGCCCA
GTGTGCAATGGCTGTAAATAGCAGCTTCCTTGGTAGTGTATGCAGCCTGTTTGTTGTATG
GGTTGCTCTAAGGGACCTTGGAGACAGTCCTTTCAGATGGCTGTTCATGTTTCCGACCTT
ACACTACCCCAATGTAGGCTCCAAACTGGCATGCGAGGTGCCTTTGGAAAGCCCCAGGGC
ACTGTGGCCAGGGTTCACATTGGCCAAGTTATGTCCATCCACACCAAGCTGCAGAACAAG
GAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCGCCAGAAGATC
CACATCTCAAAGAAATGGGGCTTCACCAAGTTCAATGCCAATTAATTTGAAGACATGGTG
GCTGAGAAGCAGCTCATCCCAGATGGGTCAAGTACATTACCAATCATGGCCCTCTGGATA
AGTGGCGGGTCCTGCACTCATGAGGGCTTCCACTGTGCTGCCGCCTCTTAATACTCACCA
ATAAATTCTACTTTCTGTCCACCTAAAAAAAAAATGCTTTAACTTCAGTTACCCCTCTCT
CTTATGTACTTTTAGTCTGTTATTTTAGTTTTATCCTGATTCCCTCACATAAACATTATT
AGTATATTATTAGTGTTGTTTTATACAGTTGTTTAAATTTATCTACTTTTTTTGCTCACT
GTTCCTTTTTGCATCTCATTCTTTCCTTCAGTGATTCCTTTCCTTCTTGAAATAATTCCT
GGCCTGGCACAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGA
TCACCTGAGGTCAGGAATTCGAGACCAGCCTGACCAACATGGTGAAACCCCGTCTCTACT
TAAAATACAAAAATTAGCCAGGCATGGTGGCAGGCGCCTGTAATCCCAGCTACTCAGGAG
ACTGGGGCAGGAGAATTGCTTGAACCCGGGAGGCGGGGGTTGCAGTGAGCCGAGATCGCA
CCATTGCACTCCAGCCTGGGGGACAAGAGCGAGACTTCATCTCAAAAAAAAAAAAAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved