Pan_troglodytes Locus Mono:84:SNORD46
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:84:SNORD46
Pan_troglodytes
Mono:84:SNORD46
7
SNORD46
1001..1104
2104
AACTAATTTTCTCACCATCAGTGTATCTTTAAAATCACTGGTCAAGGAATAATAATCCT
TTTATATTGGTAAAATTTGTTTTAATTATTCATACATTTCAGGGTGAAAACATTATTCTT
CTAATTTCAACCCTTGGGCCCAAATATAGTTCCCCTGAGAATGAGTCATCTATGACATTA
TAGGTGATGAATGGATAACAGAAATTTGCCCCCTTCCCTCTCCAATCATGGGGCAGCTGA
ACTACAGAACTTATCTTCCTGGAAGAAGGCATTTTCCCAAGTGGAATACAAGTTATGGGG
GAATGAGGGGAGTCTTCAGGTTCATGGATGTAACATTTTCCATGCTGTGTTCTTCCTCAC
TCATAAAAGTTTGATTTTTAGCATCTGGCATTAAAAAAAATCAATCCTGCCTAATGATAC
CCCTCATTCCTAATCTTTCTTTCCTTTCTTTGGGAAAATCTTTTTGGAGTATCAGTTCAC
ATTTTTCATTANCATTTCTTTTGGGTTTCCTTAGATTTTACAAGTGNTTAACCAATTAGC
ATACTTCTTAAACCTTTAAGCAAAATAAATNCTTAGAATTAACACAAATGTGTAGTCACT
ACCACAGTGACAATGAAGCCAACTATATTATTTTCATCAGCTCATGGGAAGTGTGTACAA
TCAGTGTCTACAATGAGCATGTGAAAACTTAGAGCTTCCATATTACAATATGAAAAGCAC
TTTCCACACATTTGCTCATTGTACCATGGTCTTCTCAAGACTGGCTACACCGAGCAACTC
AAACAGGTCTGTGTCTCAGTCATATTATGGCCTTAGTCCTTACCAATGCCTGGTACCTCA
CAAATGTCTTCTCGACTTTGTGAAGGGAATGGTGGCTTTCCCTGAACTATTCAGCAGAGA
TTCAAACTTAGAGGTTACAAAGTAGCTGGTAAGTGTCAGAGTGAGACACAATGCCAAGGC
TGTGGCTACTGGCAGATCATGACCTTGCTTTGAAAAGGGGGTGCTGGAGTGATGAAAAAG
TATCTTCAGGTGTGGCTGTGGCCACCTTGGCCACCTGTGTGTCACTTGCCAATGCAAGGA
CTTGTCATAGTTACACTGACTGTTAAAAAGAAACAAAGGAACAAAAAGGGAGGCGGGGTC
AATTCTGGGAGCTCTTTTGGGGTAGGAACAGTAGGAAAAATAGAACCTGTGGTTGCTTTA
AAAAAAAAATTCTGTGCCATTGTGGTTTCTCCATGGATGGCTCTTTAATTTGTATGTATT
AATTGTGTAATATAATCCTCCTTGTGGAACCCTGTATCTTTTTTTAATTTTTTTGGAGAC
AGGGTCTTACCTGTCACCCAAGCTGGAATGCAGTGGGGTGATCCCGGCTCGCTGCCACCT
TGACTTCCTGGGTTCAAGCTATCCTCCTACCTCAACCCCCCAAGTAGCTGGAACTACAGG
CACATGTCACCACCCCTGGCTAATTTTTGTATTTTTTGTCCAGACAGGGTTTTGCCACAT
TGCCCAGGCTGGTCTCAAACTCCTGAGCCCAAGTAATCTGCCAACCTCAGCCTCCCAAAG
AGGGAACCCCATATCTTCTTTTTAGCTATATATTTTATAAATGTCTAGAGTGTACAACTT
TCCTGTGTATTTTTAAAGTTTGATGATATGAGGGTCATTACCTATGGTAAATGGCCTATT
TTGGTACCTCCTGTGCAGTTTTATAATTCTGCTGATTATGATAGCATCTTATGTTGAGTC
AACCACAATAAAGATAGTTGCAGGGGGAAAAAGAGAGTCACAAGGAGTTTAAGTGTTCCA
GTTGGGGAATCTTTGGGATCATCTACAAGATAGAGCATAGTACCATGAGAAGATGAAGAC
AGAGCCACCTCAGAGCCAGCCTCAGCACTGTGGATTCCTAATGCTGCCACCTTTTTGTTG
TTGCTGTGGGCATTAAGTAAAAGAGTGTGATGGTGGATTTCATGTGTCAACCTGCCTAGG
CTATGGTGCCCAGCCGTTTGGTCAAACACCACTCTGAATGTTGCTGTGAATTTTTATGAT
TTTTAAATAATTTTCTAGATGTGATTAAATTTAATTCAGTAGACTTTGACCAAAAACAGA
TTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved