Pan_troglodytes Locus Mono:26:SNORD77
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:26:SNORD77
Pan_troglodytes
Mono:26:SNORD77
X
SNORD77
1001..1068
2068
CACTGCTATGTGCCACCTCTGCATCAGACAAATGGAAAATTGCCCAGGTCTCTTAAGCC
CCTGCCCACAGGAAATAAGCAAGTGGAAATTAAGGCTCATATACAGCCACCAATCAAGGC
AAGGTAGATCAGGACCTGCATCCTAACTCCCTGTCTCCATGATAAGACCATAAGAGTATT
CATCCTCCTCTTTCCTCTTCCACATACGGTCTCTTGTTGCTCACTTCCTTCATACTCATC
TTTCTCTAATTATAGCCTTTATTTGTGTTTATATACCCAATTTCACCCATGTTAATTCAT
GGTGTTTTCAAAAAAATCATTAAGACAGAATCATAAATAATAATATCTAACACTTACTGA
GCACTTAAATTGTGTATGAAGCACTATAGCAAGCAATTTGCATACATTATTGTCTTAGTC
AGTTTGGGGTGTATAACAAAGTACCATAGACTGGGTAGCTTATAAACAACAGAAATTTAC
TTCTCACAGTGCTGGAGGTTAGAAATAGATCAGGCGTGGGTTCTGGGGAGGGTCCTCTTC
CTGGTTGCAGACTACCAATTTCTCCTTGTAGCTTCACATGGCAGAAAGAGAACTAGAGAG
CTCTTTGGGAACTCTTTTATAAGGGCACTAATCCCTTTCACGAGGGCTTCATCCTCAGGA
CCTAATCCCCTCCCAAAGGCTCATCTCCTCATACCATCACAATGAAGGTTAGGATTTCAA
CATCTGAATTTTGGGGGGACATAAACATTTAGTCCATGACACTTAACTCATTTAAGTCTC
ATAACAATCCTTTTGGAATAGTGTCCCTATTTTACAGTTGAGAAAAACATAGTTTGAGAA
GGTGGTTGCTGAGGGCTGTAGATAGGAGAGAATGAGAAATTATTGTTTAATGCGTATCAA
GTTTCAGTTTTGGTGAATGAAAAGAGTTCTGGGGATTCATTGCACAACCATGTGAACACA
CTGAACACTACTGAACTGTACGCTTAAAAATGGTTAAAAGGGTACTATGATAGTTGCATA
GTTCAGCAGATTGAATCATCAAGAGATTTAATATTTGTCTGATGTATCTGGGACAATTTT
TTTTAATGGTTAAGAAGGTAAATGTTATGTTATCTGTATTTTACCACAATTTTTTTTGTT
TGTTTTTTGAGACAGAGGCTGGAGTGCAATGGTGCGATCTCACCTCACTGCAACCTCTGC
TTCCTGGATTCAAGCGATTCTCCCGCCTCAGCCTCCCGAGTAGCTGGGATTAAAGGCATG
TGCCACCACGCCTGGCTACTTTTGTATTTTTATTAGAGATGGTGTTTCTCCATGTTGGTC
AGGCTGGTCCTGAACTCCCAACCTTAGGTGATCTGCCTGCCTTGGCCTTCCAAAGTGCTG
GGATTACAGGCGTGAGCCACCACGCCCAACCTTACCACAATTTTTAAAATAAATAAATAT
TACAAGTTAAAAAGGCTGGAAGCATCTAAACCAAGATAGAAGCAATGATTATATTTAGAG
TACAAATGGAACAGTTGTTATATTTAGAGGTACTATTGGGGTGCATCTTATCTGGTGCAC
TTTTCTCTATTTACAAATGTACACAAATTTACAATAATAAACATAAAAATAGTTGAGAGG
GGATGAAAGGGTTGATACTGTGTGAAATGCCCCACAGGGGATACCAACATGTCCATTTCT
GGAGCCGTCTTCTCATTTGTTTCCCAGCTCCTGCCGTGCCCTCCACATCACTCTGTTCAC
AACCAGCCATCTGGGTAGGTTGATTGGCTTTCTAATGACTGTTAGTCTCCAGTAGCCCAG
AAGAAATAAAGTTGTTGTGGTTACTTTTAGCAATCTATAAACCCATTTAACAATCCAACT
TATGTAATCTCATCATCTCCAGGAGGTAAGGCCTACGGTTCTGGGCTTTTTTGTCCCCAC
TTTGCTCAGGGCCCTACAACTGTGTCCCCACAAACAATCAAATAATATACTTTGGTCAGG
TCCACAAATATGTATTGAGCAACGCCTATACACAAAACAGGAACCAAGAGTGTTTCCTGA
GGCAAGCTCACATCTCTTTTGGTAGGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_006491
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved