Pan_troglodytes Locus Mono:218:SNORA17
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:218:SNORA17
Pan_troglodytes
Mono:218:SNORA17
12
SNORA17
1001..1129
2129
TTTAAAAACAAATTAGAAAAGACAAGACAAAATAATTTTCTTAGAAATCAATTCTGACT
TACAGAAACCTGAGGTGGTGGAGGCAAAGAAAGAGATGGTGCTGGAGAAAAATATCCCAA
TGAACATTCAGAGAAAAATGGCGGTTGCACTGGTGAAGGAGCTGTAAAAAAATTTTTTGT
TAAGAGTTTAATAACAGAAATACTTCATCAGGAATATATTAAGTTTATGTTATGTTTGAA
GAAATACATCTAGGTGGAGTGCAAATTAGATTTTATCAACCTCTGATAAAATCTTTAAAC
CCCTCATGAGTCCACCTCCAGCCATTTAAAATTGTCATATCATCATAAAGTCAGCCATTC
ACTTTAAACTAATAATTAGTCCCTCAAAACTCTCACTTTGTTCCACTTTTAACCTAATGA
TGAGAGCAGGGAATAGAGCAGGAAAAGACAGAAACATACTTTGAAAAAACAAACAAACAA
AAAACACAAGCATATTTTTTAAGAAATAATGAAACAAAAAATTCCCTTAAATTCTGCCAA
AGTGCCCTAGCCAAAGGAAAACAATGATGTGGTGACTTCATTATTCCCTTCTTGTGGAGC
AAAAGAAAGTTGAGGACATGGACCATATAAGCTGTGTTGAAAGTAAATAAAACTAGGAAT
GAGAAGAATTACTTAGTGTATTTAGTCAATAAGGTGCACATTTTTTCACATTTTAATTTT
GAAATAATTACAATTGATGCATCTCAGCATTTTTCTTCCTTGGTAGCAGATAAAAATAAT
TGTGTATTTTATCTTCAATGACTTGTTAGGCTCACTGAAATACAGCAGTTTCAAAGACTA
CTCTTACTACCCTACCCACTAACTATATAATCAGAGAAAATCTAACATTTCTTCTTTATC
CCAGTTGTCTCACAAGTCAATACATTATTATCCACATGCCTTATATGGGGTTGACTTGAG
TCCCAAATGAGATAATCTGAATATACACTAATCTTTGGAACATTTTACATAGCGCTGCAG
ATGTGGCTGCTGTGTCACATTTGTGTTATTAGGTGGCAGAGAGAAGAGAGGCTATGTCTA
TGCTCAGTGTTCTGCCCCATGAACATTTGAATGTTTAATAGTCAGACACTTGATGGTGCT
ATTGTTTTATGGACTTGGCATGTTTTCCCTTCCTAGTATCTGGGAGAGAGGGTGGACCTA
GTGAGTGCAGTGATCTCCGAGGAAAGCCCTCCAGGCTGCACTATCCTCATCCAGATTTAA
CCAGCCCTGACTCACTGCCAGGTGCCAGGAGAGGCTTCTGAGGACTTTCTGACCTTTGTG
TTGGGTCAGCCACTAGGGGGTCTGAAAGGACAGTGGGAAGGTAGAGGGTGCCCTCAGCAA
GAGTAGCCTTCATTCATGAATTTTAGAAACTAGTGGTAGGAAAGATGAAGTCCATTATGT
GCTGGTTCATGCTACCCACCATGTCAGGATCATCCAGGAGGACAAAGAACTAGGAAAGTG
TTTGCTGGTGTTTGATTCAGTTAATAGTATTAACAGTAGCCACTTTTACTATGCTCTTGA
TTCTGTGTCAAGCTTTCTTGTTATTTATTTTTGAGACAGAGTCTCACTCAGTGCCCAGGC
TAGAGTGCAGTTTTATTGTGCTCTTGATTCTGTGTCAAGCTTTCTTGTTATTTATGTATT
TATTTTTGAGACAGAGTGTCGCTCAGTGCCCAGGCTAGAGTGCAGTGGCACCATCTCAGC
TCACTACAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGGCTCCTGAGTAGA
TGGGACTACAGGGGTGAGCCACCACTACTGGCTAATTTTTGTATTTTTAGTAGAGGCGAG
GTTTCACCATGTTGGCCAGGCTGGTTTCGAACTGCTGACCTCAGGTGATCCTCCTGCCTC
GGCCTCCCAAAAGTTCTGGGATTACAGGTGTGAGTCACCGTGCCCAGCCATTCTTGTTTT
TTAACACAGGAAAGAAGTTGACAGAACTTGTGACTGGCTTACAGTGTGAGCACTGGCCAG
AAAGACCAGGTGGACTGGCCCCAGCCCAGATCAAGATGCAGAGGCCAAGATGTGGGCCTT
GCCCTGTGCCAGAAGGCTGGTTGGAACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved