Pan_troglodytes Locus Mono:282:SNORA68
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:282:SNORA68
Pan_troglodytes
Mono:282:SNORA68
5
SNORA68
1001..1126
2126
TTTAGTGTGGTATAACTGTCTGCTTCATCTGCCCATTTTAATTCTAGGAGGATCTGTAA
TTGAAAATAAAAGAGTGAATTATGAAAACTGATTAAGCCAAACCCATCGTATTCATATAT
TCATGGTAAGTTGAGAAACACCTTGTGCACTTGCTATTTAGAATATATGTAATTATTTGG
AGAATTTATTAATAGCAGATGAGCGAATCCAACAGAATTGCTTTATAATTTAATGTATAA
TATTTAATTGAATAATTGATTAACTTCTGACTTTAAGTTCAATGTATAAGAAAACTTTAC
TAAATTTAAAGATACTATTGGAACATTCAGAAGAACCTAATATTCACCATATTTATGTTT
CATATGTTAGAGTTACTTAAATTATTTTTGTTACACAGTTGAATGACTTAAAATGAAAAC
AAGTACATTAAATGTATGAATGTAATTTTTTAATGTTTAAGAATTAAAATTGGCCAGCGT
GGTGGCTCACACCTGTAATCCCAGTACTTTGGAAGGCCAAGGCGGGCGGATCACAAAGTC
AGGAGTTTGAGACCAGCCTGGCCAATATGGTGAAACCGCATCTCTACTACAAATACAAAA
ATTAGCTGGGTGGTGGTGCGTGCCTGTAGTCGCAGCTACTTGGGTGGCTGAGGCAGAAGA
ATCGTTTGAACCCGGGAGGCAGAGGTTGCAGTTGCAGTGAGCCGAGATCGTGCCACTGCA
CTCCAGCCTGGGCAAAAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAGAATTAAA
ATTAAGTTTGTAAATGAGCTCACACATTAATCAAAGGCCCCCTTAAAAGTGACTGTTAAA
GTCTTATTTATTCATTAATAGAACAATGTGATTTTTATTTTGAATTTTAAAGCTTAAGGA
CAAATAGTCTTTTGATCTTATAACCTTAAATGGAATATTAATTTCTAAAAACCAAACTCA
TCATAAATAATCTTTTCTGGTCATAAAAACTGCCATCACTCATACCTAAACCCAAGAATC
ACTTTCTTATAGTGATGATTTAAACAGATGCAAACAGCAAGCACATCTTGTCACCTTTGC
GGGACTGTGGCTGTGCCCCTCGCAGAAAATTTGGAGGTTCTACATCCCTGGTGGAAAAAA
AAAAAAAAGCCTGCCATCATTGACACCAAAACACTCATAATGACAGTACCTACTGTAATG
CTTAGAAGTGAAAAAATAACGTGCCATGAAAGAGACTAATTGAAGGGGCTTAATTTAGAT
CAGGGGTTCAAAGATCTCTCTGGAAAGTGCCTTGTGAGCAGAGACTTCAGAAAGAAAGTT
TAACCAAAGGAAAATCAAAAAGAAGAGTGGTCCGGGTGGGATCCTAGAGAGAGCTTAGTA
TGACAGAGGAATTGAAAGAAGTTGGGAAGTTCAGAGAAGCTGGAACCAAGTAAGTCAGAG
GGAGAGTGGCATGGATGGGACAGGAGAGGAAGCTGCAGTCAGATCATGCAGGCCTTTGGA
GACCAGTTTAAACCATATGTTATATAAACACAAATATTATACAAATCCCTAAATGTAATG
GAAAACCTCTGAGGATTTTAAGCAGATGTCGGGGGTGCTGAGTATGGTTGAATAGCCTGG
GTATTGCACAACTCCATGTTGCACCAGTGGCGTAGTTCCTGGTGTGATGCAATATTGCCT
CTGGGCAGGTAACACAATCAAATTAGTGTTAAACAATTACTCTGGTTGCTGTAGGGAGAA
GAACTGTAGAGGTAAGAGTGGAACCAAGGAGATCATTTAACTAGCTAATGCAGACTCCAA
TCAAGTAGGCCAACACAGTATTTGTGGTGATAGGGAAAAGTGGACAGACTGTTTTTTTTT
TTTTCTATTTCCATGGCAGACAGTAGAAGTCTGGGTAGATTTCTGAATCTGAAAATAACC
TGTCTTAAATGGTGCTTGAGAAAAATTAATCGTCCATCCAGAAATGTGCTAGAGCTGATA
TACAGCAGCTTGTATTGGTTCAGTAGAGACAATGGGGTCCACCTTTCCCCAACTCCTCAT
TCAGTGACATCAAGTTGATAGCTTGAAATCTGCCTTGGTGGGAGTATTTACACCATGGAG
ATTAGCAAACCCTACCAATAGAGCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved