Pan_troglodytes Locus Mono:298:SNORA26
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:298:SNORA26
Pan_troglodytes
Mono:298:SNORA26
20
SNORA26
1001..1123
2123
CAACATCAAAACTTACAAATGAGTAGCAGAGGCTTGCAAGAAATTCCAGAGACAATAGA
ATAGCACTATTGAAAAATACTGCATCATCAATACCCTTGACAACACAGAGTAGGATATTA
TACAGAAAAACAGCAGTATCAGCAACTAACTGAGTGGAGAAACAGTAGGAATGCCTTAAC
TAATGTAGCTTAAATTTTTTCATGTTTGCACAAGAGTAATATATAATAAGAATGTTTTTA
AAGTCTAAAAGTTCTTTTAAAACAAAATAGACCCGGGCACGGTGGCTCATGCCTGTAATC
CCAGCACTTTGGGAGGCCAAGGCAGGCAGATCACATGAGGTCAGGAGTTCAAGACCAACC
TGGCCAACATGGCAAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCAAGTGCGATGG
CGCATGCCTATAATCCTAGCTATTCAGGAGGCTGAGGCATGAGAATTGCTTGAACCCAGG
AGGCGGAGATTGCGGTTAGCCAAGATCACACCACTGCACTCCAGCCTGGGCGATAGAGTG
AGACTCTGTCTCAAAAGAAAAAGAAAAAAAAAAAGAAATTCTAAGTGATAAAGCATTGTG
TAACAGTTTGAGGCTGGGCACAGTGGCTCATGCCTGTAATCTCACACTTTGGGAGACCGA
TTGGGAAGATTGCTTGAGCCCAGGAGTTGGAGACTAGCCAGAGCGACATAGTGGGACCTT
CTCTCTACAAAAACATTTAAAAATTAGCCAGGTACAGTGGTGCACCCCTGTAGTCCCAGC
TATTTGGGAGGTGGCAAGAGGATCCCTCGAGCCTAGAAGTTGGAGGTGGCAGTGAGCAGT
CATCTTGCCACTGCACTCCAGCCTGGGTATCAAAGGGAGACTCCCCTCTCTAGAAAAAAA
AAAAAAAAAAAAAAAAGTTTGACAGTTTTCTTGCTTGTGCTACATAAAATAATGGTACAT
ATTACAATTGAAGGCATCTTATAATAGAACTGCCCTTTCCTGTTCCCTTTTAAGGCTGAC
CCAGTGCATTAGGAGGCTGATACAGAAGGGTAAAGTTAAGTCTCCACAGAATCCAGGGAA
GAGACTGTGAAACTCATCTTAGAACCTTGTATGGAGTCACAGCTGAACTAGAAAAAAAAA
AAAAAAGGAAAGAAAGGCATTCCAGAGATAAAGAATAGACTAAGGAGAGGAGATATTTGA
AGCCATAATGATTGAGAATATGTCAGACTTGAAATGAATCTTCAGTTCCCCTCACAAGAC
AAATAAAACTAAATCCATACCTAGATACATGGTAGAAAAACTAAAGAATTCTGCTGACCA
AGGTATTAAAAGTAACTAAAGAGAAGTGGTGTAAAGAAAGCAAGAGAGAAACAACAAATC
CTGTCCATCCTGTAACAGTTGAAAATCTCTGGCTGGGCGTGGTGGCTCACGCCTGTAATC
CCAGCACTTTGAGAGGCCGAGGCAGGTGGATCACCTCAGGTCAGGTGTTCAAGACCAGCC
TGGCCAACATGGTGAAACCCCGTCTCTACTGAAAAAATAATAATAATAATAATACAAAAA
TTAGCCGGGCGTGGTGGTAGCCACCTGTAATCCCAGATACTCGGGAGGCTGAGGCAGGAG
AATCACTTGAACCTGGGAGGCGGAGGTTGCAGTGAGCTGAGATCGCGCCACTGCACTCCA
GCCTGGATGACAGAGCAGGACTCCATCTCAAAAAGAAAAGAAAAGAAAAGAAAAAATATT
AAATGTGTACGCTCTTTGACTCAGCCGTATTACTTCAAGGAGTTGATATCACCAAAATTG
CCTAAGTGCTCAAAGGTGTTTGTAGTTAAACAACAGGAGATTGATAAATTATGTTATATA
CATGTGATGCTATGTTTTAAAGAGGTACTGATATGAAAAAAGACGTACGTGGCATAAAAT
TAAATGTACTTTATTAAGTACTTTTCCAAGAGTTTACGGAATGAGTGCATTTTTTAAAAA
AAGTGTATTCGAACTTTTAAAAAAGCTTTAAAAGCTTTATACAATGAACGATTGAGTGAT
TATAAGAGCTGGCGGGGGAATGTTAAGAGGATGATAGGGAGCTAAGTTTAACAGAACAAT
TCACCTCTTTATCGTGTGACACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved