Pan_troglodytes Locus Mono:37:SNORD113
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:37:SNORD113
Pan_troglodytes
Mono:37:SNORD113
X
SNORD113
1001..1071
2071
ACATTGCCTACCTACATTAGATGTGGCCTTAAACATTAAGTCTTATAAAATAGCTATCA
ACAACCAAAAAATATATTTCATCTATACTTATTTTTATAATATTACTGCAAAAACAACCC
CTCAGAGGAAAAAAAAATCCATTTCAACCACCTGTTAAATTCTTGAAAGATCCAAGGTTA
TAATAGTTAAAATTAAAGCTAAAATATGTATTTTAGTAACTAAAAATTAAATAATTAAAT
GTATTATAGCAAGCAATATGTAAGTATAACTAAGATTATGCTGCTTAAATATGTGATATC
TTCATGCATTGGACAAATATTCTTCCCTTTAAAGTGTATTGACATATTACACATTTCATT
AATGTGTAGCATTTATTCATATGTCCAAAGAAGGAGAAAGAAACAAAAATACGTCAATCT
GGCTTTGTGACTGGATTTCTCTCAGGTCACAAAGCCACAGTGGTATTACCACTGATATTT
TCACCTCATAAATAAATATTTCTAGCTTAAAGCACTTTATTATGGGACAGAGAGCACCGA
ACAAAAATGAGATGTGACTTCTAGTCCTAACTATGACATATAGCTTCCCTGATCCTTTAT
TTCCTCATCTGAAAATGAGGTTAATTTATTCAACAGAAAATATTGTGATAGATTGTATAT
TATTTTCCAATTCTAAAATCGATGATTCTCTATGCATTATATATATACATGTATTTTTTC
ATCTTTAACATCTCAACTATAAAAATTAATTACAGCATTCACTATCCTATCCAACACTAC
ATTTACCATTTTCTCTTCATATTCTGGGTCCATTTCCTTTTCAGATTTAGGCGCTTTAGC
AGCAAGTTTGAGTTGAAATGAAGAAACGTTTTTCTAGAATTTCAAAGAAAATAAATGTCA
CCAAATTGCAAAGCAAGGTTCTTAAACTGGTCAATGCTCTCATTAGAAGAAGGCGGAAAG
TAATTACATAACTAAATATATAAATCAATGTGGGACATGTATGGACCAATGATGAGAGCA
TGTCACAAAACAAGGCTTATGATTAATCCAGTTCTGTACACCTGAGGTCCAATAAAAAAA
TCTGAAAAATTGTGAATGCCAAAGAAATATTAATTGGAATAAAACCCAAAAGGCAAGACA
CTGAGCTTTCTCATCCATTCTTTAATTTATAGTGTAAGAAAATGTGTAAACATTAAATAA
GAGATTTTAAAATCTAGAAAAGGCTAATATCAACCACAAACCAAATAATTCAAAGAAAGT
AAATATTAATTCTAAGAAACACTCCTTTATGTCATGGAAATACGCCACACTTTCAGAAAA
AAAACTGTGGTTTCTGTTCCTAAAACGATATTTTTAAAATTGTTTTCATAGTATTATAAG
AATATTTAATTTTTTATGTAATGCAATGTGATCATATATACTTAATATAATAGTACAGTT
TTAAACTTTTGGCTTATGTTAATTTTCTCTAACTGGGAAGAAAACTACTTTAAACTATTT
ATATTGCATAAACATCTTGTAGAAGCAATTTGTCAAGGCTACTTAACTATTAATGTTTGA
TATTTTTAAATTGTAATTTAGCGAAAACTAACATCAATCAATAACTTAATACAGAGATTA
TCTGGGGAACGGGGTTATCTCATGCACCCTATCCTTTGTAAAGACAAGCCTGTACTGGCA
AATATAAATACATATATAGAATAAGCCTCCTTCCCTATAAGAAACCAAGAAATAAAATAA
TAAAAACACAAATCTACCCACCAGAACCAAAGATGAGAGCATTTCAGTTTTAACACATAC
TTTGCATAAGAGAAAACACAAATTTGTTCGTGAAAACTATCATGGCTTTTGTCAACCTAT
TTATGAAAACTTAGGTCAAAAATCAACAGAATGTGACCTTAAACATAAGAAAAATATGGC
CCCCATTATGTCTTCCAATATTTACTAAAATTTCTATTTTGAGGAAATCCAAACTGAGAT
TATGGAATTTGACCTTGTCCAGACTCTTACTTCGTAGCACTGATCAGATATCATTCAGTT
ACACTAACCCAAATAATAACCATCTTGATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved