Pan_troglodytes Locus Mono:78:SNORA4
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:78:SNORA4
Pan_troglodytes
Mono:78:SNORA4
7
SNORA4
1001..1144
2144
AGGATATGACCCTAGAGCAGATTTTCTTTCTTAAGTCACTTGGGAACACATTAATGGCA
GGTTTTTACAAAATCGGAATCATGTTAACAAATAGTATAAGCACAAACATAGTATGATTT
CCACTCCATCACCTGAGGAATACCTGTTTACCCTCCCATGATAAACAACTAGAAAACTGG
ACAAAATGTATGAAACAATTTTGTGGATATTGATCAATAAGCAGCACCTATGATAGCTGG
GAGGAGAAGAAGGAAGGTAAATTCTTATAATAACCTTGGTTTTTCTGCATGGTGGATATT
TTCAGACTGTGGCACAGGGAGGAAAATAAAACAGCTTGGCAATCTTGCTGAGTAGAAGAA
ACAGATTAAAGTTCAGGGAAGTCAAAGTAGCTAGAATTTTCAGAGCAAAGTACCAGGAAG
AGGGGAGCTAAACAGACAGAGTCCACTTTTGTGGAGGTCAAATATCCCCCTAATTTGTTG
TATCAATAAAAATTCAGGCACACATAAATGAAATTTCTGGAGGCCAGGCAAAGAAAAACA
ACTGAGGAAACAACTAGGGAGCTACAAGCCAGAAGATTTCCAGAACTCATACAGTACTCA
GTTCCCATCAGCCAGAGTAGCCAGATCTTGAGAAATATATGGACATTCAGGAGTGACTCT
GAAAGGTTCCTGACTTAAAAGTGGTGGCAGAATTCAGTTAAAAAATTACTGGACATATGA
AGTAGCAAAAGTACGTGTACTAGAATCAGTCAGTAGAAACAGAACCAGAAATAACCAAAA
AATATGAAATTAGCAAACAAAAACCCTAAAACAGCTATTATAATTTTTAAAAATATACTC
AAAGATTTAAAGGAAAACATGAACATAATTAGGAAAGAAATAGAAGATATAAGAAAGACC
CAAATGGAACAGCTAAAAGGAAAAAACTACAAAATATGGAGTACAAAAATCACTAAGATT
TTACAAATTAAAAGCAAATTAAACCCTAAAGAAACAAAGACCTATCAAAAGTTACTTTTT
GTGTGGTGGAAGTTTTTAAAATAACCTTTACCTACGTGGGCTGTTTTGGAAAATAAAGAA
AAGACCACACTCAGCAGAGGGCTATACCCCTTAGTATAGTTCACCACTGTTTTGCAGCTT
ATATTACATAAGTGAAAAAGAAAAAAAAGGAAATAAAGATCAATGAGCCTGAAGTCATAG
CAACAGAAAGGATTGAAAGTAAGGCAGAGAGTAAAAAGGAAAAAACAGGGAAGACAGAGG
AGGAGGAGGGGAAGAAGGAGAAGAAAAGCTTCTGTGGCCTGTGGAACAACAGCAAATGTT
CTAACAGCTGTGCTGTTGGAGTTCTAGTAACTGAGAAGAGAAAGAAAGGAATATAAAAAT
TAGTGAAAGAAATCATGGCCAAAACATTACCAAATTTGATGAAAACTATCCACCATAGAT
CCAAGAAGTTCTATCAACCCAAAGCTAGATTTAAAAAAAAAACACACATAGACACAAAAT
CAAAGTAAATTATAATTAAATTGATGAAATCATTGATATAAAAACCCTAAAAGCACCCAG
AAAAAAAAATACAGAGAAAAAAATAAAAATTTACAGATTCCTTGTCAGAAACTAATGCAA
GTCAAAAGATAATAAATGTTACCATTAAAATGTTTAAAGAAGAAAAAAAATCTACCAACC
TATCAATCTACCAAAGCTATACTCAGTGAAAATATATTTCAAAATTGAAATTGAACAAGA
TTGTCTGTAGATAAACAAAACCCGAATTTCTTTACCAGCAGAAATAAACAGCTTTTAAAA
GAAGATCCTCAGATCGAGTAAAAATGATACTAGAAGAAAATATAGTACACAAAGAAGGAA
AGGGTGCTAGAAATTTTTTCTCATTTCACTTTTCTTCTTTAAAAAATTTTTTGGAAAGTT
AATTAACCATTTAAAGCAGAACTTATAGCAATATCTCTTGGGATTTATAGCTAGTAGAAG
TAAAACGTATAACAACGTAAAAAATAGAAAGAAGGAAATATATTATACTGCCGTAATTCT
TACATCATACATGCAGTGGCATAATATTATTTAAAGGTAGACTGTGATAAGTTAAGTACA
TGTAACCCTTAATCAGTGGTTCTCAAACATTAGTATAAACTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved