Pan_troglodytes Locus Mono:177:SNORD88
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:177:SNORD88
Pan_troglodytes
Mono:177:SNORD88
19
SNORD88
1001..1091
2091
NNNCTGAAGCTCAATGTGGTGGAATTCGCCAGTACACACGAGTACTTATAAAGGAAGTG
GGTGGCTGCCTTTAGCCAAGATCGCGCCACTGCACTCCAGCCTGGGCAACAGAGCAGACT
CTTACTTGAAAGAAAGGTTCATATTTTACTCAAAATAGTGTACTTGTGTACCTACAGTAA
CATTTTTCTACTTAATGTTATTAGCATTGTCACCCTTAATACTGCAATTTAACAATCTGC
TTTGTGCCTGTTGTTCCTCAGTCATCTTCGAAATGTCTTTTACAGCTGATATGTTCAAAC
CTGACTCAGTCGAGGGTCTCTGCTCATTATTTATTATTTACAAGTTGGCTTTGTTTCTTC
TCTCTTCTCTCAATAAGTTCTTCCAGGGGATTTGTGTCCTGGCAGCTTTCTCTGTTTATG
GGTTATGTGCAGGTGTAGCCAGTGCTAAAGAAACCTGCAAACAGTGGGGGATGAACACCG
GGGACATCTCCATGTAGTGCATTTGGGGTCCTACCCATCCCATGAGGACAGTCCCCCGAG
GACCTGTGACACTGGGGAGGTTGGGGCATCTTGGTGTCTCCATGAGCAAAACTGGTCATT
CCTACCTTCTGGATGAGTTTTGCGTTTCCTACTCTTTTTTTGAGACAAGTCTTGCTCTGT
CGCCCAGGTTGGAGTGCAGTGGCACGACTTGGCTCACTGCAACCTCTGCCTCCTGGGTTC
AAGCAGTTCTCCTGCCTCAGCCTCCCGAGTAGCTGAGATTACAGGCATGCTCCACCACGC
CTGGCTAATTTTGTATTTTCAGTAGAGACAGGATTTCACCATATTGGCCAGGCTGGTCTC
GAACTCCTGACTTCGTGGTCTGCCCACCTCGGCTTCCCAAAGTGCTGAGGTTACAGGCGT
GAGCCACCGTGCCCGGCCGCGTTTCCTGCTCTTTAAGCTCTGCTAGCTTGGCCTCTGTCA
CTAAAGGTAAGTGGCCTCAGGACCTGGTTGCAGAGGGGCTGGGGCTCCCATGATGTCCAG
CACTGGGCTCCGATCACCCCTGAGGACACAGTGCACCCCAGGACCTTTGACACCTGGGGG
TCTGAGGGGCCCCAGTTTTAATGGCTTGTGGACTTGCAGACTATTTCCTCCCCCACTCTC
ACTGTGTCTTTCTGTGTTACAGGTGCAGCTTCAAGCTTAGGACCACCCACCATGCCCATC
CAGGTAAGAACCCTTGCTCCTGCTCCTTCACTTACCTGGGTTTAAAATATCTCACTGTCT
AGGTTGACTTCATACTGTACCTGTAGAAACTGATTGATGTGCCAATGATTGTACTCAGTG
TTTACATACAAAAACCATCTCAGGCCGGGCGCAGTGGCTTATGCCTGTAATTCCAGCACT
TTGGGAGGCCGAGGTAGGTGGATTACCTGAGGTCAGGAGTTCGAGACCAGCCCAGCCAAC
ATGGTGAAACCCCGTCTCTACTAAAAATACAAAAAATTAGGCCAGGCACAGTGGCTCATG
CCTGTAATCCCAGCACTTTGGGAAGCCGAGGCAGGTGGATCACGAGGTCAGGGGTTCAAG
ACCAGCCTGACCAACATGGTGAAAGCCCCCATCTCTACTAAAAATACAAAAATTAGCTGG
GCGTGGTGGCGGGTGCCTGTAATCCCAGCTACTCAGGAGGCAGAGGCAGGAGAATTGCTT
GAACCCGTGAGGCAGAGGTTGCAGTGAGCCGAGATTGTGCCACTGCTTTCCAGCCTGGGC
AAGAGAGCAAGACTGTGTTTCAAAAAAAAAAAAAATTTAGCCAGGCGTGGTGGCACATGC
CTGTAATCCCAGCTATTCAGGAAGCTAAGGCAGGAGAATCACTTGAACCCGGGAAGCAGA
GGTTGCAGTGAGCCAAGATTGTGCCATTGCACTTCAGCCTGGACAACAAGAGTGAAACTC
CCATCTCAAAAAAAAAAAAACAAAAACACCCATCTCACAGCTATGGAAAACTAGGCACGC
AGACCTGGGTCCAAACCCCAGCTCTGCTGTTTACAGGCTTGGAGACATTCACCAGGCCAT
CACTCTTTTGTGCCTCACTGCTGTGTCTGTGGAGCAGGCACCGAGCAGATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved