Pan_troglodytes Locus Mono:35:SNORD14
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:35:SNORD14
Pan_troglodytes
Mono:35:SNORD14
X
SNORD14
1001..1085
2085
TCAGATTGAAGTCACTTTTGACATTGATGCCAATGGCATCCTCAATGTCTCTGCTGTGG
ACAAGAGTGTAGGAAAAGAGAACACGATTACTACCACTAATGACAAGCACCGTTTGAGCA
AGGAAGACATTGAACATATGGTCCAGTAAGCTGAGAAGTACAAAGCTGAAGATAAGAGGC
AGAGGGACAAAGTGTCATCCAAGAATTCACTTGAGTCCTATGCATTCCACATGAAAGCAA
CTGTCAAAGATGAGAAGCTTCAAGGTAAGATTAATGATGAGGACAAACAGAAGATTCTGG
ACAAGTTTAATGAAGTTATCAAATGGCTGGATAAGAATCAGGCTGCTAAGAAGGAAGAAT
TTGAACATCAGCAGACAGAGCTGGAGAAAGTCTGCAATCCCATCATTAGCAAGCGGTACC
AGAGTGCAGGAGGCATGCCTGGAGGAATGCCTGGGGGATTACCTGGTGGTGGAGCTCCTC
CCTCTNNNNNNNNNNAGAGTACGGAAAAGAGACAAGATACTATCACTATGACAGGGTAAG
GAGGCACTGTCATCTGTCTTGACAGGGATCATAATGGTATTCAATTTGAGTTACTGGTGC
CTAAGGGTGTCTAGCTAAGAGAAACTAGAGTTACACCTACACAGGTAATTTAAGGCTTTT
ACTTAGAGTTAATTTCTTTCCTAGGCCGTTTGAGCAAGGAAGACATTGAACGTATGGTCC
AGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCATCCAAGA
ATTCACTTGAGTCCTATGCCTTTAACATGAAAGCAACTGTTGAAGATGAGAAACTTCAAG
GCAAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCAACT
GGCTTGATAAGAATCAGGTTTGTGTTTTTTTTTCTTTCCCCCCCACTCAATGGAGGGGAA
GGGGGTGGTAAACCAAGCTTGAGCTGGATTTCAGTATAGGGTCACAATGATGAATGGTCC
ACAACATTCGCGGTTTCCACCAGAATTCAAGGTGTTGGCAACTACCTTCCTTGGATGTCT
GAGTGACCCAAGATGTTAAGGAAGAATAAGGCCCTATTTTAATGTTGGTAGTGGCCCTCT
TGTAAAGTATCAGATTGCGTCAGGGAGAAAGAAGGGTTATTAACATTAAAAGAACTTGTA
GTAATTCCTTTTTCTCTTCCTCAGACTGCCGAGAAGGAAGAATTTGAACATCAACAGAAA
GAGCTGGAGAAAGTTTGCAACCCCATCATCACCAAGCTGTACCAGAGTGCAGGAGGCATG
CCAGGAGGAATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCTTCC
TCAGGGCCCACCATTGAAGAGGTTGATTAAGCCAACATAAGTATAGATGTAGCATTGTTC
CACACATTTAAAACATTTGAAGGACCTAAATTTGTAGCAAATTCTGTGGCAGTGTTTAAA
AGTTCAGCTGCTGTAGTAAGTTACTAGGAATTCTCAATACTTGAATATGCAACATGTGCA
CAGGGGAGGGAAATAACATTGCACTTTATAAGCACTGTATTGTAAGTGGAAAATGCAATG
TCTTAAATAAAACTATTTAAAATTGGCACAAAAATATATAGTTTAACACTGCGTTAAGAA
TATATCTCTAAAAGTTACAGAGATATAAGCACTTACATTTTGTATAAATTATTAGTAGCA
AAATGCAATCCTGAAGGTGTAACTACAATAAAATTGGGTTTCTCTATTTCCCTTCAAAGT
TGGGTTGGCGTTATGACTATATATAATAAGTATGAAAACAATCATCTATGTGGTAATTTG
GGAGCTGGGAAAATATCCCATTTACTTTATTATAGTAATTTAAATTGTACCATTGTGAGC
CCTATTCTTACCAATTGACTAGGGAGACAATGTACCTCCTCTGAACTTCTTAACCACCTA
TTATTTATTCGATGCATTCCATCATTAGCACATAACCTCATGTTGTTCATTATTTCTTAC
ATAAATTTCTGCCTCCCACCAACACACACAAACACACATATGCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved