Pan_troglodytes Locus Mono:304:SNORD37
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:304:SNORD37
Pan_troglodytes
Mono:304:SNORD37
13
SNORD37
1001..1066
2066
ATGATGCTATGAACATTTGTGTACAAGTTTTTTTTATGTAGACATATGTTTTTAATTCT
TTTGGGTATACACCTGAGAGTATTAATAGAATCTCTGGTCATATGCAAACTCTGTGTTTA
ATTTTTTGAGGACTTGCCAAACTGTTTTCCAAAATGGCTGCATTTTATAATCTCACTAGC
TTTGTGTGAGGGTTCCAATTTCTCCACATCTTCACCCAGACTTGTTCTTTTCTATAGCTA
CATATTTGTATCTGTGGGGAAGCAGCTCCACATTACATTTATTAAATATTTAGTAAAGAA
TCTCTGCTTTTGTGCATCTCTGTTTCCATGATTATTGTCCATTCCAACCTCATCTCGTCT
TTGAACAATTGCAGCAACTCTTAAATGCTTCCTTCATGATATCCTTATGTATACAATAGT
CACAGAGATCTTTTAAAAATGTATGTGGCAAACACAAACGTTATTTCAGAAAGCACATGT
GCTAGAATTTTTTCTGTGAATACTTCTGTATCTGCAATAAAACATCAGTAAAATCTAAGT
TTTTTCAGGCTCTTTGAATTTAGATTTGTAGTTCTTTTAAATATATCTCTGAGTTTTGAT
TTGCTTTAACACTGGTAAGGGAAGTTGTGGTTCATTTGGGTTTTATCTGCAAAACATTTA
GATTAAAATGGCAGTAAAAGTCAAGCATTTATAAGATGATACTAATAGCTAACTTATATT
GAGTACCTACTACATACTGAGCAGTTATCTAAGTACTTTCTATATGTTTAACTCATTTAT
TCCTCATAAAAATTCTGGTGAGGTATTATTAAACTTATTTCACACTACAGGGGAATAGAG
GGACAGAGAAGTTAAGTAACTCACCCAATGTCACACAGCCAGTAAGTAGTAGAGTCAAGA
TTCTAACCAAAAAATCTGGTTACAGAGCCCACGTCAGTAGCCACCAAACTATCCTGCCAT
TTTGTCTTACTTATTGTCTGGAATATATAAGACTTAAAATAGTAGGTGACGACCAATATT
TTTTTTACTTTGACTTGATGTCTATTGAAGAAATCTAGCATCTGAGACTATGGGGAAACA
AAAGAAAAACTTTAAAAAATTAAAAAATTAAAAAATCATTTTCTGGTATTCAATAGGGTA
GTTTAAAATAGTCACGCTTTTATTAATTTTGAATAATATCACCATGTCCAATTATAAGGT
TGTATATTTTAAACATCCATGTTTCTATAATACCACCTAGAGGTTTACAGAATTACTTCT
GCCGTACTTAAAAACAACAGCTTGAGCAAAAAAGTACTGGACAACTTAAAGGATAACTTC
TAAAAGACATTCTTGGAAAAATAACATTTTCTGAAATGTACACAATAGTCAATGTCATGA
TATTGCCTGCCAGTTCACGTGCTACTCTTTCCTCCACGTACGTCTTTTAAACCATCTAAC
AGAACATTGTGTGTTTCTGAACATTTACATTCAATTTGTTAAATGTCACCGGGGAAAAAT
AAAACAGAGAGGACATCAGCTAATAATGTACTTTTACATTCCGTCATCCTATGCATGGTT
CCATGTCTTACCATGCTGACCTAATTTGCCATGACAGGAACATGGCCCTGATTTCAGAAC
ATTCCAACTGTGGCAATCACTAAACCTTATTGGGAATTTTTGCCCCCTTAGCAAATTGAA
CCAGATTGCTTTTCTCAGGACCATTTGAGATGGGTATCTGTGAGCAAGGCGGGTGGGCTG
TGATGAAGAGTTGAGAAATGGAGCTTTTATATTACAAATATACTGAAGCTTTATGTAAAT
GTGTATCATTACAGGGTGACTGATTTTTGCTGTGAAGGTAGATTTGGGGAGAAAAAATTT
AAAAATCATATTTTATTAATACTTCCTAATGTGTGGCCTTGGGCAAACCTCTTTCCCGAG
TTTCCTCAAGTCTAAAATGAGGATGATAATGATAATATCTATATTTCAGAGTTTATCAGA
CAATTAGATAAGGATTCACTCTAAGTAAGGATTTAGAACAATATCCAGCTTCAAAAAATA
TAAATTCTGATTGTTATAATTTTTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved