Otolemur_garnettii Locus ENSOGAG00000014454
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000014454
Otolemur_garnettii
ENSOGAG00000014454
GeneScaffold_2058
SNORD105
2196..2280
6106
GGAATTCCATCAGTCACAGAGAGGAGCTGACAACAGAGGGAAAGAGACAGAGAAGGGAG
AGACATGGGGAAATAGAAAAAGACACAGGGAGAGGCAGAGAGATGTGGAGCAGACAGGGA
GAGAGACATGGGAAGGTGGAGAGAAACAGAAAGAGAAATGAGAAGGAAATGAGGATGCAG
ACAGGCAGCAGAGAAAGGTGGAAATTTATAGATGATGAGAGACACAACTGGTGACAGAGA
CAAAATCTAGAGGAGAGCAGACCACGGAAGGGAGACAGCTGGGGACAGGGAAGGAGCTGG
GTGTGGGGGAGAGAGATGTTTAGCGCAGGGAAGGGGTGTTTCTTCCCCCTATTATAAGGT
TTGGGGTAGAAGCCGGGGGCCTGAGGCCAAGACTGTCGCGTTAACCGGAAAAGGAGAGGG
GGGAGAATTATTCACAAAGCGCCTGCCTTGCCGAGTTTCCAGAGGGTGATGTGGAGTTTC
CATCACTCAGCCCCTCCGCAGACCGGGTCCCGGAGGAGGACATCTGGCCTTCAGGAGTTG
GGGGATGAAAATGAGTAACTGTCACAGGCTCTCTTCCCTACTGAGGCTTTGCCCCAAGTG
TTCGGCGCCAGTGTGCGTACATTCTCTTTCCTCTCTTAAATCACGGGTCGAGAGTTTCGA
CCCGGGTTGTCCTTGCTTTGGGATACTTTGGGCGTCTTTATATCACAGTTGGAGGGTAAA
TCGGCCGAGGCGGGATTCGAACACTAGGATTAGTTTCTCTAAAGCCGAGAGTCACACAGA
CCCGCCCCGGGTTTCCATGGAAACAGGCACTCAGTGTCTCTATAGCAACCTTGCCAAAAC
GTCAGGCTTCATCTCCCGGCTCTCCGAGGCTACCTGATGCGCAGGCCTGTCTAGTGACGC
CATCCGGTCGCGCTAGTATCACGTGACATTGCTTAGGCGCCGGAAGTGAGCGGAACAGGG
TCCGAAGCGGCGGAAGGAGGAGGCCTCGTGGAGGAGGCAGCATGGGGCAGTCTGGGCGGG
TAGGGCGCGGCGGCCGGGGAGGCGGGAGCGAGACCGGGAACCCGGCGTGGGCTTCGGGTT
TCACCACGTGTCTCTTGCCTCCCCCAGTCCCGGCACCAAAAACGAGCGCGCGCCCAGGCG
CAGGTCCGCAACCTCGAGGCCTATGCTGCACAGCCTCACTCGTTCGTGTTCACTCGGGGC
TGCACCGGTCACAGCGTCCGGCAGCTTAGTCAGGACTGCGGCGGGTCATGGAGCCACTCA
CGCTTCCTGCTGCAGGTCTGTACAAGCAGCCCTCGTCCCANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTGGGGGTTAGTTGGTTGCCTGAGCCTGACATTTAAGGCT
AGGTTGCCGGGCGCGGTGGCTCACTTCCGTAATCCTAACACTCTGGGAGGCCGAAGCGGG
TGGATCTCTTGAACTCAGGAGTTTGAGACCAGCTTAAGCAAGGGCGAGATCCCATCTCTA
CTAAAAATAAAAGAACTAGCTGGGCATTGTGGCGTGCTTCTCTAGTTAAAGCTACTCGAG
CAGCTGAGAAAAGGATCACTTGAGCCCGAGAGTTTGAGGCTGCGACGTCATGGCACTCTA
ACCAGGGTGACAGAGTGAGGCTCTGTCTCAATTAGAGAAAAAAAAAAGAAAGAAAAACTG
GTCTCTGGAGACAGAGAAGCTGGATTGGAAACTTCACTTTGCCCAGAGGCCCTGGATCAA
GTTACTTAATCCCACTGGACCTCGGTTTACTCATCTGTCAAATGGGGAGGTGCACCTGAA
CAAGGAACAGAGGCAGTACTCAGTTCAAGTCTGATTGGCTCTAGGGGCCAGGATCATTTC
ACTCCCTTGAGTTTGTTGGAATGGTCACAGGCAAGAAAGAACATGTAACAGGATCTTAAG
CTTAAGCTTACAGAGTTTGCTTAATGAGGAATATCTGTGTTTATCTTTTTTTTTTTTTGT
AATTTCTAGGTTCGTAAGAAGAACTCCATAAAGGATTGTTTGGCAGTGGCTGGACCCCTC
GGGGTCACACACTTTTTGATCTTGAGCAAAACAAAGACCAACGTCTACTTTGTAAGTGGG
CACCCTCACTTTTCACGTCCCATGGGCCCCTCACTTCCCCCGTCTCTTATGATGAACCCA
TTTGCTTCTGAGCTGCTGTGATTTTTGGCTTCAAAGTAAACGCGCTGAAGAAGAGTTGGG
ATGGAGGTTTCCACTCCCCAGCTCCCTAAGTAGTCACCCCAACCCTCACTGATTCTTTGT
TCTCCTACAGAAGCTGATGCGCCTCCCAGGAGGTCCCACTTTGACCTTTCAGGTTAACAA
GGTGAGAATTAGGGGTGGGGAGAGGATGTGTGGGGTGGGAGCTGGGCTTGGAGCTGGCCC
TAGCACATGTGGTGGGTAGTCACCTGCTCTTCACTCTGCCCTGCAGTACACATTGGTGCG
TGATGTGGTTTCCTCACTGCGCCGGCACCGCATGCACGAACAGCAGTTTGTCCACCCACC
CCTCCTGGTACTCAACAGCTTCGGCCCTCACGGCATGCATGTGAAACTTATGGGCACCAT
GTTCCAGAACCTATTCCTCCTCCATCATGTGCACAAGGTAGCTTGGCTGCAGGGTGCTGT
GTGCTGGGATGAGCAGCAGTGGGTACCGTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTT
GCATTGATTACTGAGTCCTTTTAGAACTGAGGCTGAGAGCTCTCAGTTCCGTGGTCTGCT
GAATGCTTATGTCACAAATGTTTCATTTGTGTTCAGTGATGTTGGGCAAGAGTGTCCAGA
ATATTACCCTTCCATCCCCAGCCACCTCTTCATTTGGCAAATGGAAATCTGTGCTGATTG
TGTTTTGTCTGGTCTCTGCTGCCCAGGCTGGAGTGCAGTGCTGTAATTGTAGCTTGCTGC
AGCCTTGAACTCCTGGGCTCAAGTGATCCTCCTACCTCAGCATCCCAAAGCAGCTGAGAT
TACAGTTGTGAGACACACCACACCTGACCAGGCCTGGATTTTTAGATTTTTGTCTGGCTC
CAAAGCCCCAGCTCCAGATCTCTAGCACCATTGATTCATTCTCAAGTTGAGCTTATATGA
GGTGCTCGTCATGAGGAAGTCATTAGGGCCCCTTTATTGGGGCCAGTGCCCCAGGTGATC
CACGGACACCACTCATAGCCCCACAACCCCAACTGCTATTCATCTGTGGGAGCTCGGTGA
GGCCACTTGAAGCTCCCACCACTTTCCCTCCCAGGTGAATCTGAACACTGTCAAGCGCTG
CCTTCTTCTCAGCTACAGCCCAGAATCACAGGAGCTGGACTTCCGGCATTAGTGAGTGTT
CCATTAGGGGAGGGTGTGGAAGGCGACAGCTCTGCTGTTGAGGCTTCATGATTGCCCAGT
CTCAAAGTAAATGCCCTTGCGATTTCCAAAGGGTAGAAGTGTGGTGCTGCTCTCTGACCT
CATGACTTCATTCCCTACTCTCTGTCCATTCCCCTGCTTTTCCCCCGCAGTAGTATCAAA
GTTGTTCCTGTGGGTGCAAGTCGTGGGATGAAGAAACTTCTCCAGGAGAAGTTCCCCAAC
ATGAGCCGTCTACAGGACATTAGTGAGCTGCTGGCCACGTGAGGAGGGCATAGTGTGGGA
GGCCATCACAGTCCTGTCCAGGGGCCCCTAGAGCCACCTCTGGAGCCTGGGATCCTCTGC
TGAACCCCATGTGTTCCCTGCACAGGGGTGCGGGTCTATCAGACAGTGAGGCAGAGCCTG
ATGGCGAGCACAACATCACTGAGCTGCCTCAAGCGGTCTCAGGGCGTGGCAATATGCAGG
CCCAGCAGAGTGCTGTGCGACTCACTGAGGTGAGGCCCGGGGATAGGAGTGACTTCCTCT
GGCAGCCCCCAGCCCCACGAAAGACTAAGTCTTCTCCCATTTATCCCCTAGATTGGTCCT
CGAATGACCCTGCAGCTCATCAAGATCCAGGATGGTGTCGGGGAGGGCAAAGTGATGTTC
CACCACTTTGGTGAGCTGGGCTGGCGGGGCACAAGTGTGAGACCAGTGACGGGGGGGGGG
GGGAGCAAGGGGTCATAGGTGCGGGGTTGCACTCATTGAACCACGTCCTCCTCAGTGCAC
AAGACGGAGGAGGAGCTGCAGGCCATCTTGGCTGCCAAGGAGAAGAAACTGCAGCTCAAG
GCCCAGCGGCAGGCCCTGCAGGCCCAAAACGTCCAGCGCAAGAGGGAACAGCGTGAGGCC
CACAGGTCCGGGGTGGCAGGTGGCTGGTGGATGGACAGGGTCCTGGGTGCAGGTAGCCAC
ACTGACATGCCTCCTCCAGGAAGAAGAGTCTGGAGGGCATGAAGAAGGCCCAGACAAAGG
CCAGCAAAGACAGTGATGCTGAGGACCCTGGGCCAACTCTCAAGGCAGAGGGGGACTGCC
AGAGGGAGGAAGAAGAAGAGGATGAGGCTGAGTATTTTCGCCAGGCTGTGGGCGAGGAAC
CCGATGAGGGTATGTAGCAGGGTCAGTTCAGCTGGGTGCCTGGGGCCTGTCCTTGTTCCG
TGAGGTCCCTAGCTGACACAGTCTTTCCCCCCCAGACATGTTCCCCACAGCCACCAAGCA
GAGACAGCCTTACAGGCCTTCAGGCAGGCAGCATCAGGGTAAGGACCAAAGCAGAGGTTG
CCACAGTGACCGGAGACTGCCAAATCCTAAGAAGAGGCTCCGAAGAGCCCACAGCAAGCT
GGGGTCCAGAAGGGATGCCCAGGATCGTGGTCAAGACCAGTCACGGCCACCCAAGAAGTA
GATGGAATGCCCCAGATTGGGGCCTGAGAGACCCAGCCTGGGGCTTCAGGTGCGGCCCTC
AGTTTCCTTTCATAAAGGAGCTGTCCCTCCCAACTCCTGCCACAATAAATGCCTGAACTG
CCCAGTTCTGCATCTGCTTCCCAGTTAAAGGGGAGAGGCCTGCTGGGAGAGCCCCTGTCC
AGCAGGAGTCTGACCTAGTTTCTGCCCTGAGGCCGGGTATGTTTCTCCCACCGAGGCAGG
GGAGCAATTTCAGTGGGGAGGGCAGCAGGCAGGGCTGGCTGTGCTATGGGGATCCTCAGT
AAGGGCCCTATGACATGTCTGCTTGGGAAGAGGGAAGGAGGTGGCCATGTGGGACACTGC
TGATTGAGGTTAGAACCACAGGCTGGGCCAGCATCCTGTTCTCAACTTGGTGAGGAGCCT
GGGCCCAGTGTGTATAGGGAGCATAGTGGTCACCATCTTGGGTAAGGAGTGGGCAAATGG
GTTGATTGGATGAGGGACACATCCAGCGGCTTGAGGGGTGGCAGTGGAGCCACTGGTTTT
CAGGAAGTTTTTTTGGGGAGGTGTTAAAATATGGGTCTATGTAAGACTTCCTGCCTGGCG
GGGGCTGCCCTCATGCTGCTGGGTCGAAGGCCTTGTCAGGGGCTCTTGTCTCCTAAAGGG
CATGTCTTGGAGGGTCAATGTCAGGTTGGCTGTGATGGCCCCAGAAATCAGAGGGAGGTG
GGAAGAGAGCCTTTAGGATATCTGGCCAGTGACTGGAGTGGGTTGGCGGCAGGAAGTTAG
AGAGCATATGGAATAGGACTGCCTGGCCTTGTGGGTCGATCCTGAGCACTTGGGAGTGGA
GGGGCAGGACCCACTCAGGAACTCATCAGCACCATCTGGTGGCTATGGGGAGAGCAGACA
GCAGGAGCCAGATTTAGGGCCAGGTAACTGGGCTGGTCCAGATAGATGTGGAACTGAACC
CGGGTGGACCTGACTGACCGAGTGGGCAGTACTTTCTGATGTGCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1107..1235, 1238..1261, 1263..1274, 2049..2150, 2350..2400, 2506..2656, 2658..2665, 2668..2676, 3574..3650, 3830..3937, 4045..4168, 4251..4329, 4435..4564, 4639..4729, 4732..4743, 4745..4808, 4895..5076, 5078..5101, 5104..5106
1001..1018, 1107..1235, 1238..1261, 1263..1274, 2049..2150, 2350..2400, 2506..2656, 2658..2665, 2668..2676, 3574..3650, 3830..3937, 4045..4168, 4251..4329, 4435..4564, 4639..4729, 4732..4743, 4745..4808, 4895..5076, 5078..5101, 5104..5106
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved