Otolemur_garnettii Locus HK2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii HK2
Otolemur_garnettii
HK2
GeneScaffold_4719
SNORA42
65112..65247
107881
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACA
CGATCACGCGCCCCCCCACCCATGACAGAACCTGACGAGTCGGTGGCTCAGGCGCCTTTC
CGCCCCAGCCTCTAGCCACGGACCACACGTCCCATCCCCAGCGCTCGGCCCCGCCCCCCG
CCCAGGCGCGCCTCTCCAGCGTCCGGCTCGGGTGTCTGAGCGGCCGCGCCTGCGGGCTGT
GCGCGCTGATTGGCTGCACAGCGACGGCGGGCGGCCCGTGGAGCACACACCCTCCCCGTG
CAACCAATGGGCGCGCTCACGTCACTGACCCGGCTGCCCGCGAGCCGGCAGCCCCTCAAT
AAGCCACATTGTTGCACCAAACTCCAGAGCAGGAGTCCCGGGCCGCAGCTAGCGACGCTG
TGTCATCCAGCTAAGAAGATCTGCCAGCGGGAGCATCGCGCGTGGGAGCTTGAGAGGTCC
GATCGCCCTAGTGGAGCAGGGCTGCGACTCTTCTCAAGTTGAACCTTAGTGATTTTGTGG
CTGAAGTGAGCGTCTTGGCGTGGGACAACCGGACACGTCTCCAGGAGTGATACTTAAGCG
ACTTCTTACAGTTGGGACTCCAGAAACCTGACTAGAGACCCGAGACCTTCCCTGGCCCGG
GCGGGGCATCGCCGTTAGCCTTCTTTGTGTGCCACCCGAGCTCTCTCCGCTCCCGACCCG
CAGCCAAGCGCAGATACAAAGCGGTCTGACCGTGTCGTCCGCCTCCCCCGCACGCACTCC
AGCCTTGGTTTCCCAATTCGGCGCCGTCGGGCCGCGGCAGAATGATTGCCTCGCATCTGC
TCGCCTACTTCTTCACAGAGCTCAACCATGACCAAGTGCAGAAGGTAAGTCAGCGAGGCC
AGAGGAACTGGCTTGCTTCTGATAAAAGTTACGTGGTCTCCGAGACTCTTCTTCTCTACC
CTGCGGAGACCCGCTTTCTCCTCACTCCGGGACGAGGACGAGGACCAGGAAAAAGTCTGG
GCAGCCGAGAAACTCCTGGGCGAGAAGAGCCACGTCTGCTAGACACTGGCGTGCGTTTGC
GCGCGTGCGAGGCGCCGGGGCTCGCGCACCGCCGGGCTCTCTCCGTGCCTGCCGTCCGGA
ACGCGCTCTCGTCTCTCCCCTAGCCACTTTTTTCTGTTTCTATAGGGGCGGGCACCCTGC
ACGGAGTCCGGGATTGCTAGGCCCACGTGGGAGGAGCCCCCCCTTCTGCAGCCCGAGTTC
CGGCGGGAGCACGTGGGGAGAATCGTGGCTGGGGGAGGAGGCTCCTCTGCCTCTGTGGGG
CTACCGGGCACCTCTCGCGCGTGTAAGGACTACGTTTAGGGGACAAGCGGTTCCCTTTCA
CGTTCTTCCCGCCTTGCGGAGGTAGGCTTGGAGAGAAGCCGCCTCGGAAAGGAGCTGGAA
AGGGGGCAAAGGAACTCTTCCCGCCGCGCCCCCTTCCCGGAACTGCGAGTCCCGGAACTG
AGGGGCGTATATTCATCCCCCACCCCCGGGTCTGCCTCGGGACCGCCCCGCTTCGCGTCC
CCAGTGCCGGCCTCCGAGTCGGAGAAGACTTTGTTACTTTCTAGTTTGCTCCTAAAAGTT
ACTCGGAGAGGGTCAGCCCCTCATTCCCAGATTTCTTAAGGTTTTTGCCGTTTTGAAAGT
GAGCTTTTCCCCTGCGCTAGGCCCCGACCTTTCCGTGCCCACATGGCCTTCAGTAGTCCC
CACCACCGGAGCTCTCTCCCTGGGCCGGTCATTTACGTTAAAAAAGCGCCTCCGGCTCTC
TGGAGAACCTTGATCTCTCTGCCTCGGGGAATGGGGGTGGGACCGGAGCTGGGCCGGGCT
GGGGGCACTGTCTGAATTCAGTTTCTGAAAGGCCCGGGATTAAGGATTTGGCTCTGAGCC
AGAGCCTTGGCTGGGGGTTTGAGGTAGAGGATGAGCTGGGGAGGGGGAAATGGGGTTGTT
TTAGAGCTGTGAGGCAATAACTGAACGTTGCTCAATGACATGCTTGAAATTTCAGTGTCT
GGTGGGAACACATTTTTGGGAAAAACTCTTGACATTATCGTTCCGTGGGGCAACCTGCCC
GTATTCCCGTTCTGGCGGTCCTGAGGGCAAAAGAGAAGATGATGGGTTTCCATATTGATG
TAACGAGGGCAGATGAACCTCCACATAATAATTGACGTTACTCAGCCTCAGAGTGGAGGA
AGGAGTCGAGGGCGGCTGGTTGTCTTGAGTTTTACCATGTACATAAACGGTTGTTACTCT
CTAACTTATTCCTGGGACATGGTTCTACATTTTAATTCAGTTTACTTAACAACGTGTCTT
TGAGCTGGCAGGGTCTTGGCAACTTCTCAGCTTCCAAGATATGAGTTAACTCTTGGTGAA
GGCTATTATGTCTTGGCAAGTCCCAAAATACTAAGTGGAGTTTCCATCCCATAATCTTAG
GAATGTCTTCTCAGTTGGATGTCACCCCCAGAGCATTGGAATTCTTGTATAAATTTACTG
TTCCCAAATCCAGTGGGAGACACTAGGACTGTAAACTCAGTAGAGTTTTATCACTGTCAA
TGGGGTTGGAGGTCATCTTTCTAGCCCCAGAATGGAAAGAGCATTAGCCAAGGTATCTGG
AAATGAATTCTAATCCTTGTCTTGTGGACAGTTTAACCACAGGATTCTGAGTCTCTTTGG
ACAACCTATTTCTTTTTCAAAAATGCAGATGATGACAGCAAGCTTGCCCACTTATGAGAT
TGTGATGATTAAGCACCACAAAGTGAAATCATCCCTCCTATCAAATTCTTTACCCTGGCA
GCAGCCACCTTTCTGCCTCAGAAATGTCCCTGAGACACGTGTGCATTTCCTCCAAATTAC
CAATGGGGGCAGAATCAGCTCTTTAACTCACTAGGGGTCAAGAACCTCTAACTTAGACTC
CCTGCTTAAGTGAGCTTAGCTGTTTTGTACGAGCTACAATTAGGAAATAGGAAGAGCATC
AGAGAATATTTTGGAACCATCTTTCTGAGTTACTGTTGGAGGGAAGAATTAGAAGAGAAT
GGTGAAGACTGAGTTTAATTTAATAGTCTCTTGAAAAGATCTTTTGATTTGGATTCTTCT
GAAATCCATTTGTGAAAACATCATCTTACATATTCTGGGTTATTGTCTGAGGACATAGGG
AAGGCTTAGGTTTATCTGCCCAGCAGGACCACTTGTCTCCTGATGGAAGTCCATTGTTTG
CTGCATGAGAGACAAGAATACTTTGTCTCTCATTTGGCAAAAGTGAGTATTTGTGTTTGC
TCTTGAACTTAGAATTCAAGAGCAAACACAGAACATCTACTGTGTACCTGGACCCTTCTT
AACTCTTTACATATATTATGTACATTCACACCAACCCCATGAGGTAAGTACAGTTGTTGT
CAGCATCTGTTTTGCTGGTGAGGAACTGAGGCCTAGAGTAACTTGCCCAAGGTCACTAGG
TTTTTTTGGTAAGAGCTGGGGATTGAAGCCACACAGGTGGCTCCAGAGCACTGTGCTCGT
GACCACATACTTGTTTGCCTCTGGGGAACATTAGTGGGCTTGTAGGCCCCACCTGTGTCC
TCTCATAGATGCTGGTAGTACCCTCATCCCACAAAAGGAACTAGCTCTCCTATTACTTTG
ATCAATGACATGAGTTAGTACCCTCTGGCTATTCCAGCTGAGAGCCTTAGATTCATTTTC
ACAAACTTTCCCTTCTGACTTTGTTAACTCGTCTCTGGGCTACTTCAGGGGCCTCCTAAG
GATTTTCCTGTTTCTAGTCTCTTTCTTGAGCCAGACTGAATAATCATTTCAGAAGGCTTC
TACAACTCTGCACTGGCTGCTGAATACCCCCAATGCCTCTCCCACCTCAGCCTCATCTTT
CTCTCCATCCTTTCGTTCCCAGAGACTTAATCGCCATCCTTTCAGGCCTGTGCATACTAG
GTCCTTTATTCCTTGCTCTGTCTGTGAACTTGAATGCTTTGCTTGTCTTTTTCCCTCTTA
ACCCTTTCTAGCTCAAATGCTGTCCCCTCTCTCAACTCTGCCTACCTCCTCCCCTTCCTG
TGTGCCTACATTAGTGCCCTTGAACCTTGCATGGCATTTGTTTCATTCCATCATACATTA
GAGTTGGTGGTTTTTAGTTTGGGTTCCTTCCTCAGGACAAGAAGGATCTTGGCTTTTTGC
TTTCACCACGACAGTTCCTGGCCACTGATGAGGTGTTCAGTGGGTGCAAGAATGAAGGAG
GGGATCTTCCCCTATAAAGAAGCTGAGTGAGAGCTGCAGGAAGTGGAGGAGGGTGGGAGG
CAGCTGGGGGTAGTTAGCCCTGGGTCAAAGGGATGGGTGTGTGGGTGCACACTTAGAGGG
AAAGGCAGTTCTCAGGATTCTTTCTCTAGGCTCAGTGCCTGTGGCTCAAGCGGCTAAGGT
GCCAACTACATACACCTGAGCTGGCAGGTTCGAATCCAGCCTGGGTCTGCCAAACAATAA
TGAGAGTTGCAACCAAAAAATAGCCGAAGTGTTGTGGCGGGCACCTGTAGTCCCACCTAC
CTGGGAGGTGGAGGCAGGAGAATCGCTTGAGCCCAGGAGTTGGAGGTTGCTATGAGCTGT
GATGTCACAGCACTCTACTCAGGGTGACAGCTTGAGGCTCTGTCTCAAGAAAAAAAAAGG
ATTCTTTCTTTATCCAACCATGTTCTAAGGGGGAGAGAGGGGTAAGAGTTTCCTGTCCTC
CTGTAATCAAGGCTCAAGTCCTGTCTGAAGAGACAGAAGATTGTTTTTTTTATTAATTGA
GATAAATTAATATATCAGATTTGGAATCATGTCTTTTTTTTTTTTTTTTTTTTTAGTGAC
AGCTCCTCCTCTTCCTCCTTGCTCCCAGGAGAAGCCCAAGAAGCAGGCATGGGACAATTC
TTTTACATTACAGGACTTTTTTTTTTTTTTTTTGAGACGGAGCCTCAAGCTATCCTCCTG
GGTAGAGTGCCATGGCATCACGCTCACAGCAACCTCCAACTCCTAGGCTCAAGCAAGTCT
CCTGCCTCCGCCTCCCAAGTAGCTGGGACTACAGGCGCCCGCCACAACGCCCGGCCATTT
TTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGCCCGGGCTGGGGATTCGAACCCGCCACC
TTAGGTATATGTGGCTGGCGCCTTAGCCGCTTGAGCCACTGGAATCATGTCTTTTAAGAA
TGAGGATCAGGGTTAACTACAGAAGTGAGATGAAATATATACCCCTTCCTTTAGCTATTC
ACCACATTGTTTTAACTCGAGCAGGCTGATGCCATTTTTATTGGAATCCTGTAATATAGA
TTGCTCTCTAAGGCCTGGAGGGGAATACCTTGGATGCCAAGATTCAACAGAGCCCCCAAG
AGTCAAGGTGGCCAACAATTTTAATGTTTTTTGAGAACCTACTATGGGAGCAGGGCCGTC
TGCAGAAAACAAAAACTGATAAACCGTTCTGTTGTCTGGAGAGAAGAGTCTTCAGGAAAA
GATAATAAATGGCCACTGAGTCAAAGTAGGGTGTATTATCCTGGGTGGGTATAGAGTTAA
AGACCTAAAGGAACATTTTGGACATCTATGATGTGCCATTAATCTCTAGATATGAGAGTG
AAGTGTCAAGAGTCAACTACAGATTAAAACCTTAATAAGATTATTTTTGGCTAGGTTAAT
TTTCATGGGGGGAAACTGACATTGATAAGTATGATTTGTCTCATTTGTTCAACTTGTAAC
ATCTTAGTATCCTTATTCCAATACTGTCCCGTCTCCTGTTCAGAAGGCAACTGATGGTAT
TAGGAATACTTTGTAGCTTTTGCTAACTATTCCATTTGAATTATATTGCTTTAACTATTT
CAGAGAATGCTAAGAAGCCCCTTCCTTTTTTTCCCACCCTTGAAATGAATTAAAATTCCC
TCTGAAGCTGCTCAGCCAAAGCCAACTTTTTTTTTTAAACATCATTTTTTGAAGCGGAAC
TTTTCCAGCACTCTGGGGAGTGTCAGGGCAGCTGGGGGTCCTTATCCAGGGGGCATGAAA
AAGTGGCAACTGGAGTAAGAAGATCTGATGTACCGAAAGAACCTGGGAGGCCCAGAAAAC
TGGCTTTCTTTGTTCAGATGCTTCCGGTTTAAAAGACCAGCTCTTGATAAGAGGTTCCTC
ATTATCATTGTTGAGTTTGGAAGTCAGCAAGTTTGGTTTGTTTTCCAACACTGTATGTTG
TCTGCCTTTGCCTTTTCAAAGCAAAAAAGGGGCAAATCAAACCTCAGAGTTCACATGGAT
CACATGCCATGCTTCCTTGCAATGGAGTGGCTATTTCTGCTTATTTCTAAAGCAGTTTCC
TTCAGCCTTGGTGCTGTCAACATTTTGGGCCAGATAAGGTATTTTTTCTCTTTTTTGAGA
GGTTATCCCAGCCTTCCAGAAAAAGTTTTTACCTTATCCAAAATTTTAGGGGCAAAGCTT
GTTTTTTTTTTTTTTTTTTTTTTTAATTGCTGGGGATTCATTGAGAATATAAAGAACCAG
GTTACACTGCTTGTATTTGTTAGGCATTCTTTTAGATCAGTAGTCTCAACTAGGGGTGAT
TATTTGTCCCCGAGTGGAAGTTGGCAATGTCTGGAGACATTTTTGGTTGTTGCAGATGGG
TGAGATGCTAGTAAGTAGAGGGTAGGATGATGCTGGATATGACACAATGTGCAGGATACC
AGGTCTCTGCCCCCCAAAGAGCTATCTGGCCCCAAATGTCTATAGTATTGAGGCTGAGAA
TTGTTTCAGAAGAACATGGTCCACTCATCTTCTACCTTCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAATTACATGAAGTATTCAACACTTGATCATAACATCGGTTTGTGTTGAATGATTTTA
CCCAGTTGTAGGCTGATGTAAGTGTTTTGAGCATGTTTAAGGTAGGCCAGGCTAAGCTAT
GATGTTTGGTAGATTAGGTGAATGAAATGCATTTTTGATTTAAACCCTTTGGGATGGAAC
CCTATTGCAACACAAGCAGCATCTGTCCATAAATATACTTTCTCTCCCTCTCCATCTTGA
CAGGAGCGAACAGAGATCCTGCTTTGACTTGGGTAATTCCCAGGGGCTCCTTTTAGGTAG
TGTGGGTCCAGGCTCATCTGTGCCATCTGTCTGGTATTGGATTGGATCAGAGAACAGAGA
GGGCAGAAGGCTGGGAAGTTCCTGAAGCCAGGGAAGAAGGAAGTATCCTCACCGTCTCTT
TCAAATTCTAAAACCACTTTCTTTGGCATAGCAGACTCATCTTTGAGCTCTTCCTCTAAC
TTGCTTTCCTTCTGGTCCTCTATGAAGTGGCACCCCCATTCAAAGGTCTCGGGGACACTC
TGTACACGGGTGCACCTCAGGCTGAAGCATCTTCTTTGACATACCATGAGAGACACGGCT
GTGCTGAATGAGCACAGCATTGAAACTCCTTTTCACAGGAGAAACCTAACCCTCCCTCCC
CTCAGTGACTTCCCAGAGGAGGGCAGAGGTTTCTGAGGGCAGTTGCTGAGGCTGCTAACT
TCTTCTAGAGGCTGCCAGTTAGATTCTTGCTCCCCCATCCTCACCTCAGACTCAGACTCT
GGATTCTCACTGGGGAAACCGTTTATGGTGCCCTATGCTGTTGTCATGGGACTGGGCCAT
GGTAAATTTGGTTCCCCTGATCCATGGAGTGTCACTGAAGGAAACAACCGCTTTCACTTT
TTTTTTTTGCACATTGGGTGAGGTTCCCTGGCTATCTTGGGGCTTAGCAGAGAGCTCTTG
TCCCAAATTTCTCCCAACTCTGGGCTGTTCAGTGTATCCCCTCCTGCTGACATTGGGTTG
CCCTGGGTTCCAGATATGGCCCAATAGATTGTGTGGAACTCACTCCATCCACTGACCCCA
TGAGCAGCCTTTGTGTCATCCAAGTCAGGTGTTAGGATTCATGGCCCTGTTCCTGTGGAC
AGAGAATTTCATTTTCTCTGAGGTGCTGCCTTCTTTTAGGGGTGGCCACACATTTTGTAC
TTTTGTCTGTGGATCTGCAAGCATTTCCTTGATGTTCCTTTTCCTGGACAGACCTTGGTA
ACCTCATTGCAGAGTTAACCAAGAGTGACTCAAGGCTCTCTCCAGGTAGAACCTGGAGCC
CACCCACCTCCCACCTACCCAGCCTTCCTGCCCATCTCAGAATCCCTGCCTAGGAGGCCT
GGAGGTGGTCCATGTTCCTAGCCTCTTCCTTCTGGCATCTCTATATTGCCTGATAAAGAA
ACGAAACCAGATAAATCATCTGATGGCTTTTATTAGGGTTAAATGAGGGCATTTAAAAGC
TGCCACTTTTCCTTTATTATCATATGAAGGACTTCCTCTTCCTGCTTCCTCCCAAATTTT
CCCATCTCAGGCTTAGGGAGGGGGTGCTCAGGCTCTCCCTGCCTGCATGATGTTTGGACT
AAGGCTCTCCTGCCTTGGCAGACTGCCTGGGGCCTTGGCACTACCTTGGCACAGTCTTGT
GGGTGAGGCTGTGCTGCCTGCTGCCGTTCTCTGGAGCTCCAGGCTAACTTAGCCGCTGCA
CCCAGCCTTCCGCAGTAGCCTCCTGCTGGTCCCACTCAGCTCATGGAGAGCTGTCTTGAG
GCTCATGCTTTGTCCTTGGGTCCCTGGTTATGCCAGCCATCAGCACCTCTGCCTTTCTGC
AGGAGCTTATGTGTCACTATGACTAGAGTGATAGCCCCAATCTGCAGCGGCTGAAGGCCC
TGCTCAGCACTAGTGGTTGGAGTGGACTAGAAGAATGTTACCCCGCCTATGCACGGCCAG
AGGAGCCTCTCGATGTGCTTTGATTCTGGAAAACTCTTTGCTGCCCATAATTGCAGTGCC
CCATTGTGGATTGGGAGGAATGAGTTCCAGGATTTCCACCACCACCGTCCTCCAGCAGCT
GGACCCCTGGGCCTGCACCTCCTAGGACCGAGGAGGATGAGCAGAGGGAAGAGGGAGCCA
AGTGCAGTAGAAGTGTGGTGATTAGGTCTCCTGTGTGACCATCATCTCCCTCTGGCCTTG
CATGGGGGCCAGCATGGTGTCTGTCATGAAGAAGACCTTTCACAAATGGCTGCTACTGTA
CCGCACAGCTCTGGTAATTGGAACGTTCTACTCCAATGCCGCCTTCCAGCTCATCCATGA
GGCTTTTGGTTTCAGCCCTCTGGCAGATTATTATGTCTTCAAGTCTGCAGTGGTGTTAGG
GAGATTTTGTCTTTTCTTTTTCACAAAGAAGGTCTTGAAGATGCTTTTTAAGTAGAAAAA
TGAACATTGCACAGACATTGCCATTATGTCTCTGAGACCCTGCCTTTAAAGAAGGCCCAG
GAGGAAGACAATGATGGAAAAGCTGCAGAGGGAATTCTGGACCACATTCAACACTGCAAC
AGTGGTCTGAGTGACAAAGCCCATGGTGGACAAGAAGGTCACGGCCGGCTTACTCAGCAT
GCAGGACCTGCAGGCTTCCCAGAGCACCTATTACTGGCTAAAAGGTGTTGGTACTCTGGT
CTTGACAATCACTCTGAGTAATGGCCTGCACAGTTTCACTGATGGCCAGGCCATTGGTGC
TTCCATTACTGTGTCTGTTTTCCAAGGCATCAGTAGCTCAGTGGCCATCCTCTCTGAGGA
ATCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATATTTCTCTGG
CTGATGTGTGTTTCCTGAGATGAATGAGGTCTACCAAGAGGATGAAAGGAAGGGCAGCAT
CTTGATCCCCTTTGTCACCCAGAACCTGAGCCTCTTGACCTGGCTCACCATTCTGTTGGT
CCTCACTATATATTTAGGACAGATCCAGATTGGGTAGGCCCTGGGCTGCCTGATCCCTGG
CTCAAGGACTTGGTATCCACAAAGCACCACGGAAGAGGCAATCCTCTTAAGAATCAATGC
AGACTGTATTTCTGCATTCAAATGTCAAGCTGTTTTTAAGATGTTCTATCCTAGGAATAA
GCCACCATGCTAACCAGTCTCTTGGTAGTGCCTGTCACCCTCTCCTCTCCTTTTCTCACA
GTGACTCTGGAACCTGAATGCAGCTTGTTGACAAGCCTAACATTTTTCTCTGATCACCCT
GTACCGCACAGCTCTTTTTCTCTTGGACCACTGCTGAAAGATTTTGAATCCTTTACCTAA
CAATGCAAAAATATAGCCAGGGGTTAGACTTGTTTAGAAATATCAAGAGGTGAATCCATA
GTTTAGGGCCCATGAGTCTAAGTGTGCATCCTGGACCTCAAGCTGCCCAGTTTCAAACTG
GATCTACCTAGTCTCACAGAGAAGAGACAGGAGACAGGAATCCATCCCACTTTTTCAAAG
TCTGTTCTTTCTGTTGCCTATTACTTCTCAAAGAGAACTGAAAATCAGAGCAGAGAAGTA
GGGTTGGAGAAGGGGCAGGGATCTTCCTGCGAGAGGGGAAGTAGAATGAGGATGCAGACA
ATGCACATCTTGTCAAGAGGCTCCTTTGTTCCCACTGGGGTGCTGAATGTTGGTTCTCTG
GCAGCACCTGGTGTTCCTGGCTGTCCAGGTGAACTAACATGACGGTGTAGTTGCCTGGAT
CCCTTCTCTCAGGTCAGCACTGACAGAATGGAGGATCAGGAGCTCTGCAAGAAAACAGTT
AATTTTGCTGTAATTTCCACCTTCTCTTCCCCTTTCATCTGCTGAGAGATTTTTAGCTGC
CTTTCCAGAAGCACATTCTGAACACAAACAAAGTGTTAGTGTCAGAGGGGAGACTGCACA
AACTATCCTCCCCTGACTTGTAGAATTAGGCTTCAGTTTATGTTCTACTTAGACAAGGAT
TGGTCATCAGAAATGGAATCAGTGCAGGCAAAATTTAGGATCTGCTAATTATATAAATAA
AAGTACAAATAATAGAGGACTCTGACCTACCAGGTCAGAAACTTGGATTGGGGCACTGTG
GATGTTTGCAGAATGGTGGCCTTGAGGATTATGCTGCAAATGAGTTTTAAATATCTTCTC
TACATTATCACTTCCTCTCTTCTCCCCACAAAAAGATTGAATTCTGTATTGAATTGAATA
TGAACTGCTCTAATTCTTTCCAGAAAATAGATGGATATACATGTCCACGAAACTATAGGT
CAGCCTCAGGCGCTGTGAAGCCCTCACCTCAGAACTCTGGCTTCAGTGGGAGCTAATCTC
CAGGTTCACTAGGTGAACTGGTTTATTATTATCTTATTGATAATGTGAGATTCTTTAGCT
ACTTTGGGGAGCCAATCTCTCCTGTAGCCTAGGGGCCATGTTTGCAAACGGATTTGTGTT
CATGGCTATCAAGAGTGCTGGTTCATTGCCAATACCTGTATTTTTTCTGTTCTTGCACAG
AAAAAATGTCCACCCTCTGTTATTAAAAAGCAGCATCTGTTTTGCTTTTCTTCTTGGGAA
ACATCCTGCAAACCAGGAATATTCTTAAAAAGAATAAGAGCAGGAAACTGCTGGTGATAC
TTCAAAGTTTTCCCTTACCTTGCCTGCTAACTTTGATAGATTTGAGAATAGGCTGAAGAA
AGAGGAAAACTTCAGCAACCAAGATTCTAGATTAAATATCAGGACTGACTCCGGATAGGA
TTATGGCCCAGTTTTACCAAAGAACCAATTCCTTGAATGTTGGAATCTTAACTTTTTATG
TTATTGTTTTAGAATAAATCTTCATTTCTGTTTTATTTTTCTCAAGCTGCTTTCAGGAGC
TAGCAGAAAATAACACTCAAAGTTTAAGACTCTGGAAGATTTTGCTTTACTTCACTCAGA
CTGCTGCATTAAATCGGTAATTTTAGCATTCCCAGTATATCCTGTCATTCTTTAAAAATA
CCCTTGGGGAGTAGAATGCCAACTTAGAGTTATTGGGTTTCTAGTTTAGGAGATGAGCTC
AAAAATGTAATCTTTAGTACATTAAAAAATAAAATATGAAATAGTAGGGTGCTTTCCCTT
TTTGCACACACCTGTATTAAGCTAAGAAATTTCTTTTCATAGACAGCTGTCTCAAAGAGA
AATCCTCTTTAAACTATAATTCGAGCAGAGGTCAGTCCTAGCTGGTGCTTAGGAGGGGTG
GAGACACTCAGATCATCCGACGGATTGTAAATTGATTGTAAGTTGCCGTTGGCAAAAGAT
TTGCCTCCTGAGTTGAAAATGTGGCAACTTCTTTTTGACTTTTAAATGTTGTATTTGCTC
TTTTAAGGATTTGCATGTATCAGAGTCCAAGATGTGAAGAGTTGTTTTGAGGACTTTTTC
ACCCCTGGCATTAGCAGCTTCAGCTTCTCTTTTTCTGGGTGGACCAGCTCCTCCTAATAA
TGTTAGCAAGGAAAGTATGTTACATGCAGGAATGGTAAGCCAGGGACAGGGGCTCTGCTA
CTTCCCACCTCCTCCCTGGATGGGCAGTTGCCATTGTCCTTGCCCTAAAGGTATTTTGTA
TCTTTTGTCACCTTGGAGCTATTCCTTTCTTGCTCATCCTTCCTGGAGGATTTAAAGAAG
AAGGTTGTTTAGGCAACCTAAGATCTGTTTTTAGTAAGTCTTCTTCCAAAAAGATGGTAA
TAAGCTGGAAATCTGCTTTTTAAGAAAAGTCTGATTTTTGCAAGAGAAGTTAAGATTTTA
TTATTCATATTTCCCTTTATAGTTCTGCAATTTCATCACAGTATTTTTTTCAATAACTTA
GGTGTTATGAGAAGAAATTAGAAAAGAAAATGAACTTCTATGAACTATAAATGTCTTGTT
GGTAAGATTCTGTAAATAAAGCTACATATTCTGTAAAAAGAAAAAATTCTTTTTTTCCTG
TTTCAGTCCCCTCCACAGCCCTCTTAGCTGTGTCCCATCAGCTGTTTGTATTATAGTAAC
TCCAGCCACCCTCAGGCCTGAAGAGGCCAGGCACAAAAGGGGACAGTACCTGGTCTGGGG
GAAAGCCAGAATTCAGTCTCAGGCAATCTGACTCCAGAATGGCTGCCCTTAGCCCCCAGC
ATAAAGCTGCTCGGGACAACTGAGATGGTCAGTTTTGTTTCAGTTGCATGCGGTTATGTG
TCAGGTGCCAGCTGGGATCTCAATGAACCATTGGGATCATTATAGCCCTAACCCTTCATT
TTACAGTTGAGGATATCAGGTGCTGTGTACTAAGGGACCAAACCAAGTTCACATAGGGTG
AGCCTCAGAGGTGGACCCCAGTTTACTGATCCCTGTCATGTTTCCTTTTTATGCCCATTT
GTGAACTTTCATCATTTAGGTGGGGGTTCCCCACAAAGGAAGGATTTGCCTAGTGGGCTA
GAGGACTCTATAATTTCTTGTCCAAACTGAGCCACTTTCATTAGTGAAAGAAGGCCCTAT
TAACAGGTATGCTGGTGCCAGTGTCATAAACAGATTGTCTTGGGGAAGCAGCAGCAGATG
GGTGCCTTGCCTATTTTGGATGTGATCTTGGGGTGAGTGGGGCAGACTGGGAGAGTCTGG
GGCTGGGATATGGAGAAGAAGGACAGACACAGAGGGATTTGGCCCAGCATTTGGACAGGT
GGCAACCTGGAGTGAGGGGCTTACGTGCCATGCCACCGTGGGACAGAAGGCTTAGGAACA
GACCCTGGTCTCTGGCAGGGAGTGACGAGAAAAAGGCAGAGTCTGACCTCTAGGGAGGCC
AGTGTGCCAGGCAGGGCACCAGGTAGATGGGGAGGAAGCGATGCTGCCACCAGGATCCTA
TGCAGTGAGGGTGCAGGCCAGCTCTTCCCCCTTCACCAGGCTACTCTTCCATCTCTTCTC
TCTTGCCTTCTCAAGGCCGCTGTATGTAAACCATCTTGAGCACCTTCTATTTCTCAAGTA
TTGAGTTAGCTGCTGGCACCACAGATAAGAAGTTGGGTACATGTAGTCCGTGCTTTTAGT
CCTCTGGGACCAGTGAGGATGAAAGACACAGGTGTCAAAAGTGCATTGGCAGCACTGGCT
GGAGAGAGACCATTTGTGCTGGGCCCTGGAGGGCCAGTGGGAGTTTGCTAAGCCCAGAGG
AGGAGAATATTCTAGGCAGTGGGGCCAACAGCTACATGTTTCTAACCTTTTGAAGACAAA
TACTCCTCAGATTTGTATTAATGTGTGTGATTTAAGTCATTGTAAATCCTTACTTTATTA
CAGTAAAAAACTGCCTATGGTCTGACCTTACTTTTAGTTTGTAATTACTCGTCAACACAG
GTAACCTCCCTCCAGTAGACTGAGCCCCTTGCTGGCAGAGGCTGGTGTCTCCTTTCTCCC
AGTCTCCTCAGCGCCCAGACCTGGTACGCTCAGCTTGGTGCTCAGTCAGTATCTGTAGGT
GAGTGCTCTGTGCCAGGGTCTTGTGCATCTGGGGTGCATTGCACCTTTGCACTGCTGCCC
GCAGTCAGAACAGAATGTCTGAGGACAGAGGACCCAGGGCCGGGAGCCCCAGTGCCCATC
TCTTGGACCCCTCACAGGTGCTGCCCCCTGAGGTCTGCCTGGCGGTAACTTGAGGCAGCT
GAGAGCTAGAACTGGCAGAACAGGAAACCCTGTGACTCACAGTAGTGCAACAGGATCCTG
GAGGAGTGGCTGGTGTGTGCCTCCCTGGTGGCTCCACACTCCCCCACAGCTCAGGCACAT
GTGTCCAGGGTGTGTCAGAACTGCCATCTCCTGAGGTGGCATGGCAGTGCCCACAGGGTC
CTGCTTGTCCCATTCAAAGCACGTGGTGCAGCAGAAATGTTACCTTTGGTCAGCAGGAGA
CTAATAGCTCCATGTCGGGCTGTGTGTCTTCCTCCCCAGCTCATCTTTTTTTCTCTTTAT
CAGAAACATCTGGCCCTGCCTTGGAAATTTTACAGGATAAACTTGCTGCTCTTTGTACAG
CCTCAGCCCTCCCAAGAGGAGTCTGTGCGGGCATTATTATTAATGAGGTCACTGATAGCA
GTCACCTGGCTTTCCCAGGATGAACACACCTGTGCCCCAAGTGAGGCACTCGCCGGATGT
TGTGGGTCCTTCCAGGGACTAGGCCTGGAGTTGGGGAAACTTCTCTAAGTCTCAGTTTCC
TTGTCAAAGACTTTTGGTAAAACTCTGGCAAAGGAGGCTCGGCGCCTATAGTTCAACTGG
CTAAGGCGCCAGCCACTACCACTTAGGTGGTGGGTTTCGAAATCCCCAGCCCGGACCCGC
CAACCAACAATGATGGCCTGCAAACCAAAAAATAGCCGGGTGGTTGTGGCGGAGTAACTT
GTGGTCCCAGCTACCTGGGAACTGGTGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACT
TGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGCCACGGCACTCTGCCCAGG
GGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAACTCTGGCAAAGGAATAAT
ACAAAAATGTGAAATTCTTTTGGAGGTAAGTTGCAAGCATGTGTCAGCTTGTTGAGTCAC
TGGAAGGCTGTGTGTGGACAGACTGAAATTCTGAATCTTCCCTTGGTTTGTCCTCTCTTG
ACCTCTTTGATCTCTTTTGGCTCTTTGGCTACGTGTAGTGGAGTAGAGCCACGTCTGGGC
CACCTGCTTTTTTTTCTTCTTACTTTTTTTTTTTTTTTTGAGATAGTGTCTTGCTCTATT
GCCAGAGCTAGAATGCAGTGGTGTCACAATAGTACACTGTAGCCTCAGACTCCTTGACTG
AAGCTCAATTGATCCTCCTGCCTCAGCCTCTTAAGTAGCTGAGACTGTGGGCGAACACTA
CCATGCTCAGCTGATATTTTTATTTTTTATAGAAGTGGGATCTTGCCATGTTGCTTAGTC
TGTTCTTGAACTCCTGAACTGAAATGATCCTCTTGCCTCAGCCTCCCAAAGTGCTGGGAT
TACAGGGGTGAGCCACTGTGCTCAGCCTTTCTACATCTTTTTAATTGAAATATAATACAC
ATAGGAAATCAAATACACCAAGAAACCACCACTCAGTCCCAGTAACAGGTTATTACCAGT
ACCAGCCCAGTTCTGGCTCTAACACACCCTTCCCCTATCTACCACGACTAAGTATATTCA
CTACCCTGACTTCTAACAGCATAGATCTGTTTTTGTATATAATATCAGTGAACTCATACA
GCATGTGCCTTTTGCGTCTGGCCTTTTTCACCCAGTATTATGCTGTGCTATGAGATTCAT
CTACGCTGTTGCATGTGGTGTTGGGGGTGCACTCTTATTGCTGTGTATATTTCCTATACC
ACCTTGTTTTGACTGTGGTTGATTTAAAGCAGATGGAACAGGTCATAAGGCCCTTGGCAC
CCAGAAGGCTTGGTCCTTTTAAAATTTCTTACAAGGAGGCCAGGTTGGAGCATTGGCCTA
ATATTTAGATGACCTGGTTGCCATCTTCAGGACAAGAACATAAGTGTTAAAGAAAGCTCC
CTGGGAAGAGGTTCTAGATATTAAAGCAGAAATATCCCAAGATTAGGTCTTTGCATCTTT
TACTCTGAGGCTTCTAAGCTTGTTGGAGTCATTTTCTTATCCTATTTGATCACTCGAATG
CACCCTTCTACGAGGAGGGTGTGTCCTATAGAAATGACTGATGAGCATTTGCTCATTCAT
GTATTAGTTCATTCTGCTTATTAAAGGGATTTGGTGATTTGGTTCAGCTTTCAGTAAAAT
GATTTCTAGAACAAGAGTCATCAAATGGGCGAGGATGATTACCAAAGGAACCTTGGCAGA
GAGCTTTCCGCTTTTTGAAGTCAAGGAAAAGGACAGTTCATGAGGCAGCCATTGTCATCT
CACTGGTCTGTAGCAGGAAGAACAATGTGTCTGGGCAGCCACACTTTTTCCTGGCTGGGG
AGGGAAGTGACCGGCACAGCAGCTGTACGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCAATTGATCAAGGGCTACGTCCCACCGGG
ACTGGGAAGGCATGGGATGCAGGCATTGGGCACCAACCATTTGATTGGAATTGGTCTGCA
AAATGAGATGGACAATTCTAGGACAGCAGGGTTGTTTTTCACTTGGGTAATAAGGAAGAT
TCCTTAGTCTGTACTGTGTGACATTGTCCAAGGCTGCTCCCTACAGGGCCTCAGTTTCTC
TGAGATCCCTTTCTGGCTCTGCACTGCAGGCCTTTTCCCTTCCCAGCTTCCTCATACCTG
GGCCAAGGCTGGATCTGACTCACCATGCTCACTGCCCACTTTGAAGTGGAGCCTCTGTGG
GGGTGACCTTTGGCTGCCTCTGTTCCTTGCATCGTTACTGTGGCAGAATTTCCCCTCCTT
TTAGTGCTGGTCTGGAGGAATATGAGGGCACTTAATGGGATGGGTGTTAATGGCTTCCCA
TTTGGGGCATTAACTTATTTTATCTTTATAAAATCCTCTTTAGGATGGGGTGAAGTTCTC
TTTAGGGCTTCCTCTGTCACCAATCTCAATTCTGTAGAGGAAACAGGTGTGTCAGACTGA
TGTGTCATGGGAAAAAATGAAACTGACCAAAATTGCCCAATGAGGAAGTTTAAATCTTAC
CATTGCTAAATAGATATCAACTAGAATTGTTATCTCTTTCTGTCTAGCACACACCCTCGC
CTCCTGGCAGGCAGGCAGGCAGGCAGGCAGACAGGCAGCAGCCCTGTGTCTGAGCCAGGC
TTTGCTCTGGCCTGCCTGTGAAACCCTGGCTCGGAATGTCCCCACCTTTCCTCCTCTCTC
CCAGAAGGAGACTTAAAGAGAAGCATCCTGCATGTACACCACAGAAAGAGAAGGAACAAT
TTGGGGAAGCAGCCAGGCTTTGTTTACTCCAGTGTGACTGAATAGGGTTAAGAAATGTCC
TTGATCTTCCAAAGGTGCCACTGGGCAGAGAGACCTCTAGGAGAAAGAGGTGGGGGTGGG
GAGGAAAGGGGGCCAGGTAGAGCTCTACCCTTGTCATCTCACTTCTGCAGATGACTGTTG
TGTTCATACCAAGTTACAGTTAGGAAGTTGGGGCTCAGCTGGGGAGTGAGTCCTCCAGCG
TCACACACCCCGCACAAATGCTGCAGCTCACGATTCTCATGCCAAAGCCCTCAACTCTTC
ACCACCACCAGCTGCAAAGTGAGGGGTGGCCGGAAGGATTCTGTGTTCATGGTTTCCAGC
AACTTAAATTTCTTTTTTTTTTTTAATTTTCTTGTTTTTCAGCAACTTAAATTTCTTAAC
AACAAGTGCAGGGTTTGTCTTCCTAACTCCAGGGACCCTGGATCAGCAGGAAATTATTTC
ACAGAGACATACTTGGCCTCATATCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTCAAAATGATCTTAAGCAGTGTTGCCCAGAACAGGGCCCACCATTTCCACA
TTGTTGTCATAGCGAAACCTGCCAGAGGAGAAGGGAAGATTCCATGCTCCCAGGCTGAGA
GGTGTCGATTTGGTTAGTCTGGTATGGATCTTTGGAATTCTTATTGCTTTTAAAAAGCTC
CTCATGTGATTCTGATGTGCAGCCACGTTTGGAAAGTCTTATCACAAGTGGCAGAATGGA
AATTAGGCAGAAGTTATCTTAAAGCAGATTTATCTCTGATTGAGGAAAATCTTTCAACTG
GAGTTGACCAACAATGGAATTTAGGGAAATAGGGAGCCTCTCAGGCTTGGAAGCATTCAA
ACCTAGGTCAGGTGACTATCGATTAGGTAGACAAACTCCAATGCTGTGTTCAGTGGGGTT
TTACTCCAAGGGGCCTTTTCCCTTCTAAGAGTGAATATTTTTTATCTGTAGTCTCACTGC
TGTGTGTACACATGGTGTCTCCTAAATGGCTTTCTCTCAGGACTTTGGGCTTGGTATTCC
CTCCCTCTGCTGCATGGAGGCTGAGAGTGGGCAGGATTCTGAAAGCTGCATCCACTTCTG
TACCCCCAATCCAGGAAAACTGTCTTCAAATGGCAGCTGTTGCTTCTTTCTGATTTCTCC
TTCCCTTGTCTACCATTCACTCAATGCCACAGTGCCTGCCAAGGCTGGGTGGGCACTGCT
GGCGTGTGGAGGAAGCTGTGACATTAGGTAATTAATCATCCCTACCTGAGTGGCCCTAAT
AGGCTGAGTGGGTGCATCATAATGCCCAGGTACCATCTACTCCCGAGTTTTGACCAAGAT
GAAAGAGGGGAAGTTTGGACCAAGGTACTGGCCTTAGCATTTTTCACAGCTATTTCATAT
CCTTTCTTTTAATCTGTCTTCCTGTGATGGGAAGGAAACTAGAGTCTTGGGGGTTATTTA
AGAAACCACAGGGCATGCATCACCCCCAGGCTAAGAGGGGCCCATAGGACCTTGGTGGTG
ATCCTGAGGGCCTGACATTAGAACTAGTAGGCCTCTGTTGAATACCAGCTCTGCCCCTCA
CCACCCAGTTGACCTGTAAAACAGGTACAGAAATTTTACAAGAAGATGATGGAGGTCAAG
TCAGTAAAGTTATAGGATGATGCCAGACAGATAAGAAATGCCTGATTGTCTGGACGTGGT
GGCTCATGCCTCTAATCCCAGCATTCTGGGAAGCCGAAGTGGGTGGATCACTTGAGCTCA
GGAGTTAGAGCCAGCTTGAGCAAGAATGAGACCCATCTCAGGTGGCGCCTGTGGCTCAAG
GAGTAGGGTACCGGCCCCATATACCAGAGGTGGTGGGTTCAAACCTGGCCCTGGCCAAAA
ACTGCAAAGAAAAAAAAAGAAAAACTAGCTGGATATTGTGGTGGGTGCCTGTAGTCTTGT
CGTGGGCACCTGTAGTCCCAGCTACTCAGGAGACTGAGGCAAGATCATTTGACCCCAAGA
GTTTGAGGTTGCTGTGAGCTATGATGCCACGGAACTCTCCAGGGCAACACAGTGGGACTC
TGTCTCAAAAAGGAAAAAAAAAAAGAAATGCCTGATAGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGCCCTTATTCTTTGAACAAGGAATCCTACACTTTTATT
TTGCAGCAGGACCCACAAATTCTGTAGCTGGCTGTGCCATCATCATCCAGAACTTGTCCT
CATGGGCCACAGGCTTTTTCTCTACCTCAACGCCTGGCATCATGCTCTGCAGTTCCAGTG
TTGATCTGGTTGATCCATACTCCAGGCACATATGCTTCAGAAAAGACAGTGTATTATGTT
AAACTAAGAAGTCGTATGTAGCTGAAATGCTTATTAAAATTGATACTATTTTAGACAAGT
TTGTTTATCTAAATACTTTTTTTTTTTTTTTGCCAGGGTTGGGTTTGAACCTGCCACCTC
TGGCATATGGGGCCAACATCCTACTTCTTTGAGCCACAGGCACTGCCTACTATATTAATA
AATTTTAAAATTAGATTACAAACCAGTAACTGTATACATATGCTACATATGTACTCAAAG
TATCTGAAAGGACAAATATGAAAATATTTATAATAATTATTTCTAGATTATAAGAACATA
GGTTTTTAAAATCTGTCTTCTAGCTTTTTCTCAATGAACATTCATTACTTGCATAAAAAA
TACGTACTTTTTAAAAAAGTTGAATTCTGTGATGGTTAGTTCTGTTTCAGCTTAGTTGGA
CTAAAGTGTCAAGATATTTGGTCATACTATATTTGATGTGATTAACATTTAAATCAATAG
ACTTTGAACAAAGCTGATTACCTTCCATAATGTGGGATGAGGCTCATTCAATTAGTTAAA
GTCCTTAATATTAAAATATCATAAAATTTAACTATGAGTAGCTAGAAAAATTTAGATTTC
CATTTAACCATTTATTTTTTGAGTAGAGTTGCTAGGTGATGAAAGTACAAGGACTGGGTT
AAAATATGTCTTTTTTCCCCCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTATTGC
TTGGTGTTATCACTGTTGCCCACAAGAGCTTTTTGTGCTGGATGTAGCCTGGTATTAGTC
TCTGGCCTGGGTGGCCTGAAATTTTGTATATTAGCACCAAGATGTGTAAGCTGTGACCAG
TCAACGTGTCATTGGATCTGGACTGGGAAGCATCTGGGGTGGGCAGAGCTGCCCTGTGTC
TAGGATCACTGGAGAAGCCTGGACTCTGACACTTCACCAGTAGGGAGGGGGCTTGTTTGG
TGTCAGGTGGAAGCTTCACTCTATTGCCTCCTGTCTGTCAAATGTCATCCTGGGGGATGT
ACCCTGTAGGAAGCAGAGGTCAGTGACTTAGCTTGGGGGATGGAGCCCTGGAGTACTGAG
GCAGATTCAGGACAGTGGGCTCAAGGTGAGTGAGGTACCAGGAGTCAGTAATCAAACAGG
AGGCCCAGTGCAGTGGCTTACTCCTGTAAACCTGGCACTCTGGGAGGTTGATGTGGGAGG
ATCACTTGGGCTCAGGAGTTTAAGACCAGCTTGAGCAAAATCTAGACCCCAATCTCTACT
AACAAGCTAGAAAAACTAGCTGGGAATTATGGCAAGCTCATGTAATCCCACCTACTCGGG
AGGCTGAGGCAAGAGGATCATTTGAGCCTAGGAGCTTGAGGTTGCTGTGAGCTATGATGC
TATGGTACTATACTGATATTGACAGACTAAGACTGTCTCAAAAAAAAAAAAAAGAACAGA
AGGGACAGTTGGATTCTTCCTGATTTAGTCCTATGGACTTTAGTGTGAGGTGGCTTTCAA
TAAATGCTGGCAGGGCGGTGCCTGTGGCTCAGTGGGTAGGGCACTGGCCCCATATACCAA
AGGGTGGCAGGTTTGAACCTGGCCCCGGCCCACCTGCAACAAAAAAATAGTTCTGGCGAC
CTGTAGTCCCAGCTGCTTGGGAGGCTGAGGCAAGAGAATTGCTTCAGCCCAGGAGTTGGA
GGTTGCTGTGAGCTGTGATGCCCCAGCACTCTACCAAGGGCAATAATGTGAGACTCTGTC
TCTTAAATAAATAAATAAATAAAAATAAATGCTGGCAATAGGGAAATTCTGGGAAATCCT
CCTTTCTGTAGTTCCAAACCTAACATGACAAGCCTGGTCTCTCTCCGGAAGACCAGGGAG
TGAGAAATGGTTTGGGGCTGCTGTTCAGGAGGAAGTTGCCCTTCTACCATTCTCTGCTCC
TCCTCTGTACCCCTGTATCACCTTCCAGGTGAGAATTGCATCTCGCGATTGCCTTGTGTT
CAAACCCTCAGCAGTTGTGGAGGGGGCTGGGCTGATGGCTGGAGACCCTCCTTGCTGACT
CCTAGCTGTTTGCAGCATTTCCTCGGACTCTGGTCTTTCAACTTTGGGGACTAAGAAGAG
TGATAAAAGATTAGTACTAGTCAGGATCCTTGAAATGATCTGAGCAGGACCAATGTCATT
ATTCTACAGGGACAAAAATAGACCCCAAAGAAGAGTATGTCCGAAACTCCCTAAGGAGTT
AGGATACAACCTGGAAAGAAGATGTGTTCGGAAACTTTTCTCTTTTACTTTGTCACAAAG
GAGGACATTGGATTTGTTCTTTGTTCTCAAAGGATTAAACATCTTTTATTGTTACTCTGG
AAATCTTAGGCTGCAAGCTTAGTTAAAAAAAAAAAAAATTCAAGGGGCCCTGAAAAAACC
GCTGGAAAGCATGGAAGGCGCTACTCGTAATGCGCATATTTGTTGAGAAAGTTATTGTAA
AAGTCGCGCTTCTTTGTCAGGCTGCGCAAGGGCAAAGGACAGCCAACCATCTACTTGTGT
TTCTCACAGGAATGACAGTGGTAGCAGTCATCTGCTGAGCTTTGCTCTTTGGAGTCCTAG
AATTTCAGAGTTGGAAAGGCACCTTCTGGTGCCTCAGTTTGGTGACACTGCTCGGAGTGG
GGGCTATGCCACTCATACCTGAAGGCGTTATTGAGAGCTGGTCCAATACTCCTGAGTCTC
TCCACTCCTGCTCTGCTACTGGCCAGGGGCTCCACCTGTCATGGACACTGCTGCTGGGAA
CAGTGATAGTGGGGAAACTTGTATGTCTCTTTGGATAAGTTTCTACCAGACCTTTTCTTG
ATTGGAGAAAACTAGGACTATCCATGGCCAAGGCAGATTAGAGCTTCCAAGACGGAAACC
ATCTGAAAGGGCTCCTAATACTTCTCCTTCTCCTGGTGTTAAATCTGGGAAATGTTCACG
TAGATTAATGTTGAAGGCAAGGTCAATGAAATGGCTAGGGAGTATTTCTACCATTGCTGA
GCACAGGAGCGGTTGCGTCATCATGTACATAGAACCTCTCCTATATGTCAGGCGCCATTC
TAGGCTCCGGTGGATGCACAGCTGAGCACATAGACACTGTTCTTCTAGCCCCTTTGTCCT
TATGGTTCAGACACTACTAAATATATATTTCCAAACTGTGGATGGTGTCGTGAAGGGAAA
AGCTTGAGTGGTTGGAATAACAAGGAGCCTTGACTGTTACATTCAGGAGGATCACAGGAG
GCCTCTGCAGAGAGAGGATTGGTAAGAGACTGCAGGTCCTGGATGCACAGGGCCCAGACT
GGGGAAGTTGGGGAAATGAGCCAGGGATAGTTTCTGCACAGAATGCAAATACATGACAAT
AAGATTGGGAGGTGGGCAGAGGCCGGACCTTGCAGATCCTCGGAAGGATTTCAGATTTTG
TTCCAATGGGAAGTGCTGAAAGTTTTAAGCTGTGGATCAGTGGAGTCTGGCTGGGGGTGG
AAAATGGATGAAGAAGTAAAAGTAGAATGGGGGGTCATATAAGTCTAGGTAAGAGTTGTG
GCTACTGGGCCTAGGGCCAGGGGCAATGTGTAGAGACGTGACTGGCCACGTGAGGTGTGT
GGGGAACAAGAGATGAGGGTAACGAACCCTGGTTCCAGGGATGTTGTCACAGGCATTCGA
ACTCAACCATTCTAAAAAGAACTTACCTCTTCTCAAATAATCCTTTTCCCTGATCTGTAC
TGTTCTCTAGAAATAAAATTAAACCTCTTTTTATAATTTTAATTTTTAGAGTTTTCTTTT
TTTTTGTTAAGACACTATCCTTTCACATCAATTCCTAGTACTGGTCTTTCATAACAACCT
TCTCTATAGAGCAAATATTTCTTTTGAAGGGCTGCATGGTGCTCCCTGACATGGGCCAAT
GCCTACTTTATTTAACACAGAGCCTTTACTCTCGTTTTCCTCCTCTTTCAGGTTGACCAG
TATCTCTACCACATGCGCCTCTCTGATGAGACCCTTTTGGAGATTTCCAAGCGGTTTCGC
AGGGAGATGGAGAAAGGGCTCAGAGCTGCCACCCACCCCACTGCATCAGTGAAAATGCTG
CCCACCTTTGTGAGGTCCACTCCAGACGGGACAGGTACTGCAGCTGGAGGGTGGCGCTGG
GCTCTTCATTGCTGAGGGGAGGTTTTGTTGGCTTTGCTCAGGGACCCAAGAAACCATGTG
TGAGTGAAGGGTCCTTGGTTTTACGCCTCAGAAACCAGCCAGGGAATAGAATGGAAAACT
GTGGGTGGTACAGACAGCAACCTTGGCAGTCAAGGGAGAAGCCGTCCCAGCCATTTGCTT
TCCACCTATGTGCTGAGAAAGGCTGCTTGGCTTGGTTTGGATTTGACAGCCCCACTGAAA
TTGCACAGAGTGGTGGCGAAGAACCACCACAAACATGCCTCACATGGTCACAACCACAGG
CCATGGCAGGCGCTCTCTGTCCCACCTACACATGCCTCAGCCGGCACCTTCAATAGGCAT
GCCAGAGAAACAGTGCCACACTGATTGTCCTGGATTGTGTCTTGAAAGTACCAGAAGTCT
GAATAAACTTGGGGAAAATGTAAAAAGCCACTGTGTATGTGAAGCAATTAAAGGCTCTTA
AGTCCGGCAGTATGAACCTGTTAAGCTCGATTTAATCCTCTTATTTGGATACAGAATCCT
AATTTCACGGGGCAGCACCCAGAAAGTGATTTAATTATAGGGAAGAAAAGGGTTATGGTC
AGAAAGGTGTGGGACAGGCCAGATTGCAGAAGGCCTTGCGTGCAAGCCTAGAACACTGAG
TCCTTCAGTAGGCGCTGGGGAGTAAATGCCAGTTTGTGAGGGGTGTGAGCAGAGCTGACC
TTGCGGTGTTGCAGTATCTGCAGGGTGAGGAGGGTCATGTGAGGCTGGGAGAGCACAGAC
GTGGCCCTGGTGGGTGGTGCCTGGCAGCTGGCAGTGGCAGGTGGGGAAGAGAAGATTCGA
GGGTGAGTCCAGCTGCCCCAGGATGCGTGTGGTTGAGTCAGAGCTTTGAGACACCTGTTT
CATATAATCTTCACAGTAGGTGCCTCCATTTCCCAGACAAGGCAGCTGGGAGGCCCATGA
GGGCCTGGGGGTGGGGGGTAGCTACTAACATCTAGGGGGCAGGGGAAAAAGCCCAAAGGG
CAGCTGCCAGGGCAGTGGGAGGACCAGGGAGCACAGCGCCTGGAACCTGAAGGAGGTGAG
ATCTCCAAGACACTGGCTGGTGGCTGGGGAGGTGTCTGCAGAGGGGCCTTGGGGATGGGG
TGGTGGTGGTGGTGTGTGGCTCAGGGCTTGTTTGTGTTCTTCATGTCTGCTATTTCCACA
TTTGTGTCCTTGAAGCTCACCTCCCTAGTGTTTCTAGAGACCTGGTTTGTCTAACAAGAC
TTTGTACAGTTCCTAAAATAAATATGTGTTTGCAGAAGCCTTAGGACCCAGTCTGGACCC
AGAACAGAGGGTGTGACCTTGTTAGGATTATTTTGAATATGTGTGTCACAGCCCTTCACA
GAGCCCCTTGAGGTGAGGGGCCGCTGAATTATTCCTCTGTGCCTTCCGGGTTGGTGTGTT
TGCTGCACCTACCACTCCTTGACTGGAAACCACACCTATTTCCAATGTTTTAATTTAATG
TTCTGACAAATTCATTAGCTTCGGAAGGCTCAGGGAGGGCATTAATCTATTAATGAGCGA
TCTGCTCCCATGACCCAAACACCTCTCATTAGACTGCCCCTCCAACATTGAGGTCAAGTT
TGAAGATGAGATTTAGGGGGATGCACATCCAGACTATGGCAAATGGACACTGGTTAATTA
ATGCAGAAGACAAGAGTCCTCTGTCACCCATTCTAAAACGTGAGCTATAGTATTATGTGG
AGTGTGATCTCATTTTGTAAAATAGTTACATGTATCTATATTCATATTTGCAGATTGCAT
ATACACATGTGTATGTTCAGCTGCATAAAGTCTCAAAGATATGTATCGGACTACTAATAG
TGGTTATCCTATCATTTGAGTTTAGCAGTCTCTAGTAAAGGGAAAAATGTGTCTGTATGA
AAACTGAGTGATTCCACTTCCAATTATATACCCTGAACAAATTCTCACATGAATCCAAGG
AGACCTGGTCCAGTAACGTTCATAGCAATGTTGCTGATAGTGACAGCATACTGGAAAGTT
TAGGGTATATTCATGTGATATGGGATACTGTACAGCACACATTACATAAATGAGCACATA
TATGGATACAGCTCAAACAATGAGTGGAAACTTTTGGGAGGGCATATGTCTTATAGAAAC
TGAATGTAAATTTTTCTTTTCTTTTTTTTTTTTTGAGACAGAGTTTCAAGCTGTAGCCCT
GGGTAGAAAGCTGTGGCGTCAGAGCTCACAGCAACCTCTAACTCTTGGGCTTAAGTGATT
CTCTTGCCTTAGCCTCCCAAGTAGCTGGGACCACAGGTGCCCACCACAACACCCGGCTAT
GTTTTTTTTTTAGTCATTGTTATTGTTGCTTAGCAGGCCAGGGCCGTGTTCCAACCCGCC
ACCCTAGGTGCATGTGGCCAGTGCCCTTGCCAATTGAGCTACAGGTGCCGCCCCTGAATG
TAGATTTTTTAATAGCCCCTCAAAGACTTTGTTTACATTGCTTCTGGACACATATACACA
CATCGTAAAGTTATCATCTATAAATTGGCGTATGTATACCAGATAACTGATAGGTGTTAT
TTCTGGTGAGAAAAAGGGAAATGGAACTGGGGAGGAGAAGATAAACAGCAGCAGCAGAAT
GGTCAGCACTGAGGCCCTTAAGTTTGCTTTCTCAGTTGAGGGTGTGGGTTTTGGGATGTG
GCAAGGAGGACTGGTGACTCCCAAGTCAACACAGACTATCATAATAAACAAGAATCCTCC
TTTGTCCTTGGTACCCCAGTGAAGTGCTGAGAGGAAGGCCTGGGGCCACAGCCCGGACTG
CTGCTGCCACCCAGGCTGGTGGAGATGAGTCTTTGCCCCTGTGGTGCCTGTTCAGTGCCA
TCTTTCTCAGAACCTCCTTTCTCAGCTCAGTCATTCCCAGCGTTTCTTTTGAAATCTGAG
AAATTAAACCTCAGAACAGAACTCTGATCAGAGGGACCTAATCCTTAAATCAATAGCTTG
CTAACTTTTCTGGACTGTATCTTCATGGCAAGAAACACCTATATGTAAATATTTATATAA
AATAAAACAAATGCATGGGTTTGGATTTATGGTGGGCCTGTTCCCCTGGGCCTCTCATAG
TGCCCCATGCCAGAGCAAACTGTGGCCCTGAACTATTGCCTGGCCTCTGTGTCGATAGGC
TGCTGGCACTGAAGTGGGTTGCACAGAGGAAAGAAAAAATAAGAAAGAATAAATAAAATA
AAACAGAAGTTTTGGGGACCTATGTTTATTTTTATTTTATTTTATTTTATTTTTGTGAGA
CAGAGCCTCAAGCTATCCCCCTGGGTAGAGTGCTGTGGCATCACAGCTTATAGCAACCTC
TAACTCGTGGCATCACAGCTTATAGCAACCTCTAACTCCTGGGTTCAAGTAAGTCTCCTG
CCTCAGCCTCCCAAGTAGCTGGGACCACAGGCGCCTGCCACAGCACCTGGCTATTTTTTG
GTTGCAGCCATCATTGTTGTTTTGGTGAGCCAGGGCTGGATTCGAACCCGCCACGTTAGG
TGTAATGTGGCTGGCACCTTAGCCATTTGAGCCACAGGTGCCAAGCCCCTATGTTTATTT
TTAGACATGATGCAGTCAGATCTGTTGTCTTCTGTTCTTGAAGAAAGTTGCAAGTTGGAA
CCTACTAAATGTTTTTCAACTTCTAAGTTTGAAAGTTGCTGCCTTAAATGATCCTCAGAC
GCGGGAGTCTTATTCTACACTGACATTTATGAAGTTGGCTACTGAATCACNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCCTGAAACTCCAGCATACATCTTAGAGTTTAATATTTGTTCTTTGACATTTGAT
GTAAGAGCTATATGTAATGTGATCACAAATCTTAATTCTATCATTTGATCAGCTGACAAA
TACACACATCTATTTAATACTATCTCTGTCAAGATAGAAGAATTGCTGTCACTGCAGAAA
GTTCCCTTGGGCCTCTTTCCAGTTCATCCCTGTCCCCCATTCCTGGAGGCAATCACATTC
TAATATTTTCCACATATATGTTTTACCTGTTCCAGAACTTCACGTAAATAACTCAAACAG
TATCTGTTTTTTATCTGAATCTTCTTTTACTCATCATAATGTGACATTTATCCTTGGAGT
GCCTATCAGCAGTTCATTCCTTCTGGTTGCTGATTCCGTGATATGATTGAAATCATATAT
GATGTGAAATGATGGACAGCTGGACAGTTTCCAGTTTGGGGCTTTTATGAGTAAAGCTGC
TATGAACATTCTTGCACAAGCCTTTTTGTAGTCACATGTTTTCATTTTCTTGGGTAAACA
TCTAGGAGTGGAATTACTTGACCTTTTCCCCAACTTGTTAAACCATTTACTCTCCTACAA
ACAATGTATAAAAGTTCTCCCTGCCCCATAGCCTCACCAGTATTTGTTGTCTGCCCCCCC
CCCCCGCCCCCGTCTTTTTGCAGTGGAGAGTTGAGTAAAGAAAGCATTCATCAATATCTG
CCAGGAACCACACCACCTTGTCCTCTCTGTAGGCAGCCCTGGTCTAGGTGACAGCAGTGC
ATGTGATTATGATCCCGAGAATCTACCTACGGTTCTGTCAGGGCCACCACACACATCCAA
GGGGGCTGGCTTTCAAAGAAGAGTTCCTTCTTAAGAGGGATGTAGGAATAATTGACCTCA
TTTAATGAGCATCTACCCTGTCTCTACCCTGTTTACATTAATCTGTTTACTCTCCATAAA
TACCTTAGAAGAGAGACAGTCTCACTTTAAACATTAGGCAGCTGAGGCTAAAAGAGGGTT
GATGGTTGCCAGGGTCATCTGTGGTCAGATGGTGACAGTACTGAGATTCAAGTGTAGGTA
GCCCTGACTCTATGGCCATTAGATTCACAGTTTACATTGGCTCATGTTGCTGAACCAAAG
TTTCCAGGGCAAATCAGATTATTATCTTTTAAAATGGATTGTAAATAGGAGTTGGCTCTG
TACAAGTAAAATAAGAAGCTCAAGTAGAACCCAACTGAAAATCTATAAGTGTTCCAGCCT
CCTGTTCTAATTTAGCAATAAAGTGTCTTTATGGTATCTTTGTGCCCTCGTTGTCTTGGC
AAGGTCATTTGGACATAACTATGCCTTATAAGGCAGAGAGAAGGTGAGGCACTGTCAAGT
CGATCATTTAATCCTTCTCCACTTCCCTGAATGGTGAGTTGTTTTCATAGGTAAATGTAT
CTCCATCCTCTAGCCAGACTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGCATCACAGCTTATAGCAACCTCTAACTCCTGGGTTCAAGTAAGTCTCCTGCCTC
AGCCTCCCAAGTAGCTGGGACCACAGGCGCCTGCCACAGCACCTGGCTATTTTTTGGTTG
CAGCCATCATTGTTGTTTTGGTGAGCCAGGGCTGGATTCGAACCCGCCACGTTAGGTGTA
ATGTGGCTGGCACCTTAGCCATTTGAGCCACAGGTGCCAAGCCCCTATGTTTATTTTTAG
ACATGATGCAGTCAGATCTGTTGTCTTCTGTTCTTGAAGAAAGTTGCAAGTTGGAACCTA
CTAAATGTTTTTCAACTTCTAAGTTTGAAAGTTGCTGCCTTAAATGATCCTCAGCCCAGT
CTTATTCTACACTGACATTTATGAAGTTGGCTACTTCTTGCCAGGTATGAAATGAAATGT
GTAGTTTCAGACCAGTGTAGGGTGAAGGGTCAGAATCAGAACTGCAGGTTTTAATATGTT
CAAATTCAAGTTGTATGCTTCAGAGTAATCAGTGTTAAGGGGAGAATCAGATATGTGACT
TTCCCACATGTGCTAGGGAAACTCTCCTGCAGTCACAGCCCACCACTGCAGAAGGCACAC
TTAGTGCCAAATTTATTGAAAAAAGTGAGTGACCCTCTCAGGTTCTTAATTTTGGAGTTG
ATTAGTGTGGAGGGAGCAGGTGTGAGTGTTCATCCCATCTCCGAAAGCTCTGCAGTTTGG
AGTGAAGACTAGTCCCGGATTCTTTTTTATACGGGCCCCAGTTATCTAATGGTAATAAAA
GTCCTGATCAAAACTTTAGGAGAAACATTAGGAAGTTTCGGGCCATTCATGTACCATGTA
GGCTAATGAACGTCTGTGGCATGGTTTATGGCTTCTCTGTAAGAAGGTGGGTAAGTCAGC
AGCCCCCGAGCCCCATAAGGACGAAATGTGCAAGGCCAATTCTGAAGTTCCTATGCTTCA
AGATTGTGTGGACTACACAGTGTGAAGAAATGCAGTTGGCATAGTGGAAAGTACAGTAGA
TTTAGATAGTCCAAAGATGTCTTACTCAGATGACAGAGTATATAAAAAAAGGTGTCAGCC
AGGGTATATAAAAAAAGGCCTTAGGCGGTTCCTGTAGCTCAAAGGAGTAGAGTGCCCGCA
CCATATACTGGAGGTGGCGGGTTCAAACCTGGCCCCGGCCAAAAAAAAAAAAAAGGCCTT
TATTTGTTCTTTCACATTTCCCCCCAATTTTAAAAATGCTGAAAGAATTCTATAGTGAAC
ATCCATATTTTACTAGATTTGTTTTATCGCACTCATTCGTCATCCATCCATCCATCAGTC
CGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCATTTAATCCTTCTCCACTTCCCTGAATGGTGAGTTGT
TTTCACTATGTGTAAATGTATCTCCATCCTCTAGCCAGACTTAACTCCCTAGAGAGCAGG
GAATGATGCTGCTGATGCTGACAGCGATGATGATGATAAAAATTGTAAGCTAAGCGCTGT
ATTCGAGCCATCTCATCAGGTCTCACAGTGATCTGATGTTACATACTCTGAACTTTATTT
TAAAGAAAAAGAAAATAGATTTAGCAAAATTAAGCAAGCTGCCCAAAATCACATAGTGAG
CAAATGGCAGCGTTGGAATTTGACCTCTGCCGGAAGCATCACCAATGCGTGGGCCCTTGG
GCACACCACGGGTGGCATGTTTTATGTTTATGCGCCCCCTACACTGCTAGCACAAATACG
CTATGCATTAATTCTTCTTTTAGTAACAGGTTGAGCTGTTCATTCAGTCATCCTCCTGGA
GGCAAGGTCCTCTGTGCTAAGCTGCCTTGTGCCTGCCTTTGAAGAGTGAGAATTGTGCTG
GAGAGATAAGGCCTATGCAGACAAAACAATTAGAGAGAGATATTGGGCCATATAATGTAA
GCACATGATATGATAAAGGGAGACGGGGCTGGTAATAGGTTGCATGGAAGCTAGTTAAAC
CTGAAAGAAGCCCTTATCTTGGTTGCTCTGTGTTATATCAACAACCATGCAGGGGAGACA
TAAATCAACAGCTAGTGCTAAGTGTATTTATGTGGTGTGGACTGTACTACTAGATAGCCT
CTGTACAGCAGATGGCATTTACACATACCAGGAATCGCACCTGATTACACTGAATCTTGA
CGACTTATGTATGTATACGTGTGTGTACATTATTCCCTCCCCCCCAAAAAGGGGGGGAAT
AATCATAACCTCCCCTAGAGTGGAGGTGCTGGCTAGAAGGTTATGATTATTTCCTCCTTT
TTTTGAACAGATGATGAAGCCCATGTGTCATATTTCTGATAAATTACCCCAAATCACATC
ACTAATACATGTTAAAATAGGATTTAAATCTAGGTCTGCCTACCTAAAAAGCTTAATATG
CTCAAAGCCTACACAATATTGAAATAATCTTGTTTTAATCCTTTGAAGAGTGATCTCATG
ATTTCCCATCTGTGAGGCCTATGCCATACCTCTCTGTGACTGGCACATATTTTCAGCTTA
AGAAATATTTCCTAGGGTGGCACCTGTGGCGCAAAGGAGGAGGGCACCAGCCCCATATAC
CAGAGGTGGTAGGTTCAAACCTGGCTCCAGCCCCAGCCAAAAAAAACTGCAAAAAAAACT
GCAAAAAAAAAAAAAAAAGAAAAAGAAAAATTTCCTGAGTAAAAAAAGCACCAGGACAGT
GCTATCCAAAGGTGATCTAGGAGCTTGAACTAACCATGTATTTCATGTGCTCCAAGCCCT
AAAAGGAAAAAATAAAGCCCTCTCAACCCAGCCCCTCTGTAGAAGAAAATGGGAATGTTT
AGTGCAGTCACCTCGGGCCCCTAGAAATGCTGTTGTAAGGCTGGAGGTGCACTGGAATTG
GATGTGGAAGTATAGGTGTGTCTTTGACCACTCCCAAGTTAAGGCTGCATGTCTCAAGTA
TTGGGTGACAAGGAAGGGCCAGAGGCTTATCGTCAGATCTGATACAGTCCAGCCATCCTG
ATTTGCTTGGGCCTCTCCCAGGCTTACCACTGAAAGTCCTATGTCATAAAAAAACTCTAC
TGTCCTGGACAAATTGTGGTGGTTAACCACTCTACATGGTCCTGGAACCCAGGCCTTCAT
AGCTGTTCAGGTGGACTAGTACAGAGGACTTCTAGCCAGCCTCCATGGTGATACTAGGGC
CCTTCTGAAAATAGTCTGACCTTAAGAACAAAAGAAAGTCCTTGGCAATGGCACTAATTT
ATTTTTTAGAGACAGAGTCTCACTTTGTTGCCCTTGGTAGAGTGCTATGGCATCACCTCC
AGCTCTTAGGCTTAGGCGATTCTCTTGCCTTAGCTTCCTGAGTAGCTGGGACTATAGGCA
CCTGCCACAACACCTGGCTATTTTTGTTGTTGCAGTTTGACCAGGGCCAGGTTCAAACCC
ACTACCCTTAGTACATGAGGCTGGTGCCCTACTCACTGAACCACAGGCAGCATCCTATTG
TGTGCTTTTAGCTGTGTCTTATGAGCTCTATGTTATAGTCACTCTGGATATGCCATTTTT
GGCAGCCATAAATCAGAGCTACCTCATAGTTATGCCAAACCTCTGTCCTGCTTTACTGGA
TGACCAAGCATGCAGGGAACCTCCACACCTGTATATGTCCTCTTCTCTTCATACTCACTA
GGTCTTGGCTGTCTCATCTTGCCTTCTAAGAAGCCTGCCTTGTCTGAGCAGAAATAATCA
TTCGTTCCATAATAGCTCTTATCATGATACTTGCTCACTTTCTCTCTGGCAAGTCTAGGG
TGCATGCGGCACCAGGCAGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCT
TTAGTAGAGAGTTAGTGCCCCTTCCCTGTCTTATTATTATTTAATTTTGGGGGGTAGGAG
TGGGAGCACTTTTAATGAAGAGGATCTTCAGCAGAAAGCACTTGGAACTCTGCAGTGAGG
TGGGAACAGAGGTTTGGTATTGTTGTGAGAGAGCACTGATTGTGACTACTGAAAAAGGGC
CTGCAGCAGTAGGCTTCATTTAACAAGTCCCGGGTCCCTCTGGGAGAAGGGGATGCCACC
TCCTGCCCGTTGGTGTGTACCTGCTGCTTCCTTTACCGCTGCCTCCCCTCAATACGGAAG
GTTGGGTCTGGAAAGGGCGTGGCCATCCTGGAAGCTCAGGAGTGGGCTGTGTTCAGGCCA
CTCTTGCTTTCTTTCCCACCACTTTATGGCTTCCAGGAACCAGAGCCAGGAAAGATGTGG
GTGTGGTGCATAGGGACAGTCACAGGCTTTGGAGTCAGATGGACCCCTATGATCTTTACA
AAGTGATTCAACTTCTAAGCCAAAGCGTTACTTCCTCATCACCCAGCCTAGCTTGGGGGC
TGCTGCCACCTCTGGGTTTTATGCTTCTGGCATTGCTAGCTAAGAATTCCTAATTTAAGG
ATTTATCATGTTCCCATGAGCAGCACCATGGCTTATTGCAGTAGAAAACCTGGCTAGAGC
CAGAGCTGGATTTGAACCTTGATTTGAATTACTTGACCTGAGTCAAGTTTTCTTATTTGT
AAAACTGGGATTATAATGCCTAACTGGGTCATTGAAGATTAATGAGATAATGTCTATATA
CAAAATGCTCATCGCTTAACACACCTTAATTTTCTCTTGTGCTAAAGACATCTACATATT
GGGCCTTTAGTCTACTAAATCTCTCTCACACCTGCCGTTGTCTTTTCATTGTTTTATTGC
CATAATAATCCAGATGCATATTTTAACATACAAAGAGCTTTTTTAGATTATCAAGGAAAA
AATTAGTATCTTTTTTAAAAAAAGAGAGAAAAGACACAAACAGATGATTCACAGAAAAAG
GAGTCCAGAAGACCAGTCAACATTTCAAAATATTAACGTCACTCAAATGAAAGAAACCAA
GTTTAAAAAGTGAGAGATCACTTTGGTCTAGCAGGTTGGTGAAGATTAATTGCTACCTGG
GATGTGGGTGAGTGAAGCACACCGGATGAGAAGAAACTGATAAACATTTAGAAAGATAAT
ATGGCATTATCTTCCAGCTTGAAAACACACATCTTTGGGAACAGCAATTCACACCTTTTT
TTGAAAAATGTGTGTTACAGCTTCCCCTCTGTTTATAAAATAAATGCACCTAAAGACACC
CAAGAAACTTTAATAGTGATTATTTTGGGGATGTAGAGAAAAAAGGAGATGGTTCTGCTT
TTGTACTGATTGAACTTTTTTTAACCAGATGTTTGTATATTATTATTTTTTAAAAGTTAA
AATTATTATCCAAAGCTAAAATCATGCTTAACAATAAAAAGAAACCTTCCCTGTGACCTG
GTGGTCTCCTATATAAATCCTACAATTGGCTCACAAACATTAAGTTTCACAAATGAATGA
TCAGAAAACAAATGCAATATGAGATGGTTTCTTAATAAGTTGCCTCAAATACCAACCATA
ATTACTCAACACAGTGTTCTCTCTGGACCGTATTGGGTCCTCTGCCATGTAGCTTTGTAG
TTTCCTAAGAAACCTGCCGCAAGCATGTTGTTTGCCCCCCACCCCGCCCCCAGCCTCTTC
CCTGTCCTGTCCTGTCTAACCGTCCCATGCCCACAGATGCACGCGTCCTTGTCCCATGCC
CGCAGATGCACGTGGCCTTCACATGCGTCACGTGTTCATGCTCACTCTGCTCTGGGTTTC
TAGAGTGTCCTGAATGTTCACAGTGGAGGTAGATCTTGAGCCACCAGGTAGCAGTAGAGA
GGGTTTGGAGTGACTGAGGAGAATGATAACAACAGTGGCAATGACTGCAGCTGTTACTTG
ATGGCTTCCTGCGTGTCCGTACATCCCCAGGTAATGTAGTCCGTATTTCATGTGAGCCTC
CCCACCGCTGGAAACAGCACTATGTTGTACAGATGAGGTGACACACATAGAGAGCCTGTG
ATGTGCTGGTGCCTCCCAGATAATGAAGCTGCTGAGCTGGAATTCAAAACAAGACCTGCC
CACCTGCCCCTGGGGTCCAGCACTCCCTGGGGGCCTCTCAGGCATGGCGTGGAGGTGGCT
ATTAGGAGAGAGGGGTCCACGCACTGCCCCGAGGGTTGCCTCAGGATTTCTGGAGTCACA
TTCTGGGCCTTCCCCAGATCCTGGGGAATAGCTCTTGGCTATGGGACTTGTGGTCATGTG
TGCTTGCAGAGGGCAGTGCTGAGAGGAGGGTTCAGAGAGTGTCTGTTCCAGAGGAGTCCG
TAAGCAGAGCAGGGATGACGGTCCCTCCTGGGAACTGAATTACCAGCAGTACTCTGTTAT
TCATAGTTCCCCCTCAGCCCATCAGAAAAACACTACCAAGCCACCATTCTTGATGGAGCT
GTGCCGTCTAGTGTGTCCAGCTGGGCTGACCTCGGGTGACGACCAACCAGGGGCAGCCCC
GCCGCCTCAATCCCCCGTGGCCACTGATTCAGCGGATCGCATGTGTCCTGGATTCAGAGC
GCTGATGAGGCAGTTCATCTTTGATTTCCTTTTCATCCCTCATGACAACCACCACATAGC
ATTTCCTAGAATCTGGCTGAGGTCCCACTACCCGGGAAGGCTCAACACAGTGTCTGGAAA
AGTCACCCATGGCCACGAGGGGGGCAGAATCACTCCAGACAGGGGTGACATTGTTCTTGG
CAGCCAGCAGCTGGAGCTAGTGGAGGGACTGCTTCCAGTTGATGGATAGAGGGTGGAAAA
TCAGTACTCCCGAGAGGAGGAATGCTGAAATCACCGGGGACGAATGCAGTGGCTTTTCTT
GGACAGGTTTTCTGCCATCATGGCCTGGGGTTGGTATGAGCACTGTTTGTCGAGAGCTTG
GAGAGAAAATATCTAGTACTTAGCGTGTCCTGAGTTCTTGGTACCTGCTGGGCTCTTGAC
GTACTTTGTCTAATTTTTCCCCTCATGGCAACCCTATGAGATATGATATTCTCATTTTAG
AGATGAGGCAGTTTGAGATCCAGGCTAAGAAAATCACCTCAGCTAAAATGTGGCTGGGGT
TCTGATGCAGGCTCAGAGCCAGTTTTCGTCTGCCACATCCCTGATGGCTAGTTGTGTGGG
AGTCTGCTGGAGGATGTCTGCCTCGAGTTTCCCCTGCGGACACCAGGTACTTCAAGGCCA
AAGAACTAGAGCTGGGGTGGGGGTGGGGAGCCTGGGCACAGATCAGACCTTGTTAAGTCA
TTTAATTGGAGCATCGTCCTAACCCATTGGCCCATCTTGTCTTTCTTCGCATGGGAAGGG
GGCTGAGTGCTGACAAATATGCCAAGAAGTGACACCTGCACCCCCCAGGAAACTGCCTCC
TCTCCTCAGACAAGGTGTGTGGCAGGGCAGTGGGAGCCCAGCGGGGAGGCTGCTGTGGGG
TGCGCCTTGCCCGTCCCGCCAGCCCCCTGCCTGGCTGTGGGCTCTGCGCCTCTTCAGCAC
TTTCATTCTGTGACACACAATGGGGTACTTCCCTGTAGCAGACTGCATTATTGTCCAGAA
TCTGGATGTTTCCCGTCCACACTGCTACTTCCTGGAGGGAGAGAATAGTACCTTCCTGGT
GACACATGAAGATCTTGGCCCATTTGTGTCTGGCTCCCTTTTGGAGGCACATTCCTTCCC
TCCCTGGCTCCCTCACGCCTCTGCAGCTTGTCCAAGTGGCCCAGCTCTTACACACTCTGG
GGTCAGCATTGTCTCACATTCTAGTGAGCCTGAGATCCTTCTTCAGGGCACTTGCTTGTT
TCATTTACTAGGCCTTCATTTACAGCCAGTTGGACCCATTCCACTCATCACGGGACCCTC
TAATCCCGCTGTAGGACATTGCCATCCTGGTATGCAGACATTAGAAGGGACATTTTATAG
TGCAGTCACAATTTGGCAGGAGGCCCAGTGCCCTCAGGCCTGCAGCAGCTGAATGTTCTG
GGGGTCTGAAGAACAAAACTGAGGCATGGACCCCTGGTGCAGGACTTGCTGGGCCCTAGG
ACCTTGGTTTGGGGGCTTGCTAAAAGCACTTAAGAGGTAATTGGCTCTTGTGGGAGGGTG
AATGCCCCCAAATGGGAAGTGAAACTGTCTCTTTGTTGCTATAAATTAGAAAAGCAATAT
AAAAGTACTCAGCAGTAAGAAAATCGGACAGTCCACAATGGAGTGCAGAGATAAGTAAAT
TCCCAGGGCCACGGGTGACCAGCGTTCATGGAGGAATGGGGAATTGAAGTCTTGGTTGGT
TTCTGAAGCAGTTTGACCTTCTTATATTTCCTGAAAGTAATAGTGGCCCTTCTTCCTTTC
TCTGCAGAACATGGAGAGTTTCTGGCCCTGGACCTTGGAGGGACCAACTTCCGTGTGCTT
TGGGTGAAAGTAACAGACAATGGGCTCCAGAAGGTCGAGATAGAAAACCAGATCTACGCC
ATCCCCGAGGATATCATGCGGGGCAGCGGCACCCAGGTATGGCCTTTTTGTGAGGGCAGC
TGCTGCTTGAGAAAAACCTCTCTGTGCCTCCCCAGCTGCTCCCAGTCACCCAAGACACCC
CTGGGCACCAGCTCAGGGGCAGGGATTCCCTCCTGGCTGGAGGTTGGGCTATTCCTGCCA
TATTTTATGCACAGAACGTGTTTAGGAATAAAAGGAGTGAGTGGAGGGGAAATAGCAAGG
TGCTATCCCAGTGTTGTCATGTCATCTCTTAGGTCCCAGGGCAGGGAAGAGGTAGAGCCT
TGTGACTCCTAGTGTCCTGTTCTTTCCACACCACCAGGCCACCTCCTGGGAAAGGAATTT
TTGACCATGAGTGGAACACGTGAGGGAGATATTTTTAGACCCTTTATTTGTCCTCTGGGG
GATGGCTCTGGGGTAAACCTGCTTTCCTTGCTTTAATGCTGGGTTGGCAAAGGGAGGCTG
GGTTCCTGGTACTTGTGGGCATTTTAGCTTTCCTGGAGGGGTGACACAGCTCCAGTGTGG
CGTCAGGGAGGACACAGAGGGCAGAGGCTCCTCCATTGCCTCCCCTGTGCTGTACCAAGC
TGCCGTACTGAAGAGGTGGGACCTTGTGTTTGGCTAGTCCAGTTGTGCGATTCTGGGCAA
GTGATGGCACCTGACAGAGGCTCAGTTTATTCATGTGTAAAGAGGAATGATAGTGCTTAG
ACTGAGCTGTGGGTTAGAAGAGGTGATGCCTGTTCTGTATTCAGCACAATGCCGGGCATG
TAAGTTAGTACTCTTGCTGTTTTCCACAGGGATAGCTGTCTATCTAATTGCGTCTTCCTA
CTCTGCTCTCAGATTCTGTGGCCAGTAATTGCATTACTGTCCATCATGGAGGATATGGTC
ACCTTTTCTTCAGTCGTCCTCCACCAGCGCCATCCTCTCGGTTACAAATATTTGAGAAAG
TAGCAAATAAGGCAAAACCAAAAAAAGTGCCTAAAGTTTGGCTGGATTGTAAAAAAGGCT
TGTAACATGATGACGATATGCTGGATGAATGTGTAAGTTTTTATGAGAACAACACCCGGC
GTGCATGTCTTCCCATCTGCATAGCCTGTTGCTCGTACCTCCACACCATGAAGGGCCCAA
GTACCTTGTAGTCCTTGCAATGTCCTCCCCAAAGCCTGGCATGGGCTCAAGGCTCCTGCA
GACAATGACACATGTCTCTGCCAATCAAGAAAGAAAATCTATTTCAAACACTCAAGATGT
GAGTTAAGTTTTACTTGAAAAACTTACATTAAAATCTCTCACACTTTACATAAACAAAAT
GTTTTAGTCCAGATTTTTGAAAAAAACAATTATGAGGCTCACCTCAAGGAAACAATATTG
GGACATTAGAAACATGCTGAATAAATGGAAAAAATGCCATATAAAAATGAAACAGAAAGA
AAACTAGAAGACAATATAGTTGTCTGTTTCACTCTAAAGAATGGAAAGAATACTGTGTGC
CTAAAAAACAAAAGAAAAGCCTTGGGAAAAAAGGCTGGAAGGAAGTTCATAGATGCTATT
TTAGTGGTGGAATTATTGGGGCCATTTCCTGTGTTTTCTATTTTTTTAATATTAGGCATC
AATTTTTTTTTTTTGAGACACAGTCTCATTTTGTTGCCCTCAGTAGAGTGCCATGGCATC
ACAGCTCACAGCAACCTCAAACTTTTGGGCTTAAGCGATCCCCTTGCCTCCAGCCTCCCA
AGTAGCTGGGACTACAGGAGCCCGCCCCAACGCCTGACTATTTTTAGAGACACGATCTCA
CCCTTGCTTAGTCTGGTCTCAAACCCATGAGCTCAGGCAATCCACCCTCCTTGGCTTCCC
AGAGTGCTCGGATTACAGGCATGAGCCACTACACCTGGCCTTAGGCATCAATATTTTAAT
TCAAGAAAAACAAATTAAAAATACAATTTAGTTGAAATCAGGATCAAAGCTGGGCATCAT
GGAATGTGCCTATAGTCCCAGCCACTCAGGAGGCTGAGATGGGGAGAACATTGAGGGTAG
GAGTTCAAGGCTATAATTGTGTACCTATGAATATCCGTTGCACTCCAGCCTGGGCAATAT
AGTGAGACCCTATCTCTAAACAGAACAAAGCAAAGCACAACGAAACACCAAGACCAGATT
ACTAAACTCCAAGTGCAATGGTCTTTGAAGAACTGTGAACCTGGTCAGTGAGGGTCTCTG
GGTAAAATCTGTCCTTTGGCACATTCTCTGAAGAGAAGTGTATTGCACACCTGAATAGCA
GCTATTCAAGCTGCCCAAGATCTTAAAAGTGTATCTTGTGGAAGAGGAAGATTCTCAAAG
CAGATTCTCACACCAATAGGGAAAAGGCACCATTTTAACTTCATAAAATGAGGCCCATTG
AGCCGTTTTCCGACAGGAGGGTTTTAGCATTTTCTCAAAATCTTTTTCGTGGGTTCTCAG
CAAACAGAAAAGGAGATAGCCTTCCAATTCAAGGAAGCAGATGATCTCCTCTTCTACTTT
CAAACAGGTAAAGGTCCTTTGAACCCAGCACTGGCCAGTGGGATTTTTGGCAGTGATGGA
ACTATTCTAGTCTGTGTCTGCCCTGTGCAGTGTGGTAGCCACGGGCCACCTGTGGCACTG
AGCACAGCTGGTGTGACTGAGGAACTGAATTTTAAATTTTTAAAAATTATAATTAATTGA
AATAGCCACAGGTAGCTACTGGCTACTGAATTGGGCAAGGCAATGTTTAATACCTCTTCT
CTGCCTCCCCTGTAGGAGTTTAATTGGGAAGGGAGCAGAGGTCATGGCTGAGTGTGGGAA
ATTATTTTGTTTCTAAAGACCTCTGCCCCCAATCTTCAATTATCAGTCTTATCTCTTTGT
ACATCTTCTACAACTTCCTTTTTTTGGATAAAAGCTATTTGTACTAAAGATTATTTTCAC
TAGGATACCAGGAAGAAGGTGCTGGGAGTTTGCTTAATATACATATTGTATAGTTTGTCT
CCAACCAGCTTTCTGACAGGACAGAACTTGCTTGATATCTTTCTATGTACATATTAAAAT
ACTTGACCTCTGCTCAAGGGAATTAGCTCATGTACCTTAATGATCCCCAAGTGGGATCCC
CAGCCTTGTCTTTCCCAGTCCTTGTTCTTACATGTTTTGGTTTAGAGGTCAAAATTGCAG
TATCAGCTGTGGTCAGCTTGGTGTGGAATCAGACAGGGGACACAATCAGTGCAGAAGGCT
CAGTGAGAATCAGTCAGGAAGGTGACTTGCTTGTTTCCTCCCACTGACCATAGCTCAGGA
ATCAGGGGATCCAGTCAGCCTGTCACCCTCCCTCCTTCAACCTCTCGGTTCCTTTGTAAG
TGCAGATACCGTCTGTGGTTTAGTGTGGTGCTTCTCACCTAAAATGCTTGCTGACCCCAC
ACCTAGTTTCTGCTGAAGTAAGTCCAGGGCTGGGCCTTGAGGTGGGCACCTCTGACTTGT
GCCTGGTGATGGTGGTGATGCTGCTGCTCCAGGACCACGCTGTGGGACCTGCGTGTGAGT
GGATTCTCCTTGCTCATTCCCAGAGAAGAAGAGAATAATTGTCTTCTTGCACTCACCCTG
GCTTTTGGGTTTTGCCACCTGATGAACTTGGCTCTTGGAATCTGCCCAGCCTCTTTGGCC
TCTGCTTACTTTTTGCTCCAGAATGACCATGGCCTCAGCCCCCAAGCATCTAGAGGTTCA
ACATCTTCTCTTTGAGGGTTATCAGTGTTCTCGTCGTCAGCCAGAAGGAGGTAGATGTTG
CCACTCATTGTGAATATGTTTATTGTAAGGCTTAGGACCTCAGCGGCCTACTCAGCTTGG
TGCTGGCTCCTGACTGACTCACCCATAAATTGCTATATCTTTTTCAGAGCTCCTCATGGA
CCCAGTGTGTGTTCTGTTATGAAGATAGAAAACAATGATAACTTCCTCGAATTGTCCCCT
GAGATTAGCTGTCGAGAATGGAGAAAAAACATAGAAGTTTTTTATTTTTGTTTAGTTGGG
TCATAGAATGCCAACAGAGATTGTTCTACCCCCTCCCCCAGTCACAAGAGACAGAGCTGC
TAAAATACTACTTGGCAGTGAAATGGGCTGTCCCTCTGGTAAGATAATCACCTGGGCATC
CTTGTCAGTGGGATTCTGATAGGGCTACCAAAGGATGTTCTGTTCCCAGGGCATGCAGTG
ACTTCCTGATTAATGCTAGCCATGACTTCCCCTGGCTTGCAGGGTTGTTTTGGTAGTGAT
TTGGGTAAGTGTTTAAGTGAAAGATGACATTTAATGAGTACTAATTAATGTTAAGCCCTT
ATATATATTGACTCATTCATGCCTTTTGGTAACTTCATGAACACAGGTCCAGTTATCATT
CCCATTTTGTAGATGAACAGATGAAAATTTCGGAGGTGATACAGGTTCTGCGTACATTGA
ACTGGGTACTCTCTGAGCCAGAAGTCCATGCTCTTAACCTCTGTGCTGTTCTGCTTCTCT
CTCCTCTTCCTGCATCGTGCGCCCTTAGCTGTTTGACCACATTGCTGAATGCCTGGCTAA
CTTCATGGAGAAGCTGCAGATCAAAGAGAAAAAGCTCCCGCTGGGTTTTACCTTCTCATT
CCCCTGCCACCAGACTAAACTAGATGAGGTGAGATGGGGTCTTCAGACATATTTCTTGCT
TCACCCTTGGAGCTGGAAAGACTGGGGGGACTCCCGAGCCACCTGCTCTGGGGTTGGTGA
CAGCTCTGCGGGGTTGTGCAGATGGGGTTCTGTTCTTCTGGATGACCCTGTGTGTGTGAG
TGGAGGGTGGGTGTGAGGGATGGTGAGGAAGTGTCAGAGAAGGGTGGGGTGTTGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCCCCCTTCCAGGCATATTGAG
CAGTATCCTCAGCCCATCCAGAGAAACAGGAATGAAAAGTCAGGAACTCTTCTTGCTCCA
AGGTGTTAAGATAAAGATCCTGGGAAGAAATATTCTTGGGGAATTAATTATGTAAAGATG
TAAAAGTAAAGCCAAGTGTCGCTTAACAATGGAAGTACGTTCTGAGAAATGTGTCACTGG
ACAATTCCACCATCATGCAAACTTCAGAGTGTACTTATATAGACCCAAGTGGTGTGGCCC
ACTACACACCTAGGCTGTGTGGTATAGCCTCTGGCTTCCAGACTGTAAACCTGAACTGAG
TACTACAGTTAATTGTAACACAGTAACACAATGGTAAATATCTGTGTATCTAACATAGAG
AAGGTAATGCACTATGCTACAGTGTTACAACAGCTGTGACATCACTGGGCAATAGGAATT
TTTCAGCTCCATTATAATCTTCTGGGACCACTCTCATTGACCAAAATGTTGGTCATTGGC
CTAAATCCCGTTATGCTACACATGACTGCACCTTAGTTTGGCAGTTTTATAGCCTCCCCA
TTCCACTTCTTGGTGGCAGTGCATTATGAAGAAATCATTCATTAATCTCCTTTCCTGGTC
TTCCTAGACTAGTCAGGAAGCAACATCCAAATTCATGACTTCAGGTTAGCCCAGCAGCAG
ACATCTCTGCTAATGATGACTATTTGAGGAGTGTGGTCTGAGTTTCAGTTGTGGGAAATC
AATATTCATTCTTTTGTCCTTTTCCAGAGTTTCCTGGTCTCGTGGACCAAGGGGTTCAAG
TCCAGTGGAGTAGAAGGCAGAGATGTTGTCTCCTTGATCCGGAATGCCATCCAGCGGAGA
GGGGTAACTAGGGTGGCAGGAGTTTGGGGTCTGTAGGCTCTTTGAGGTCTGCTCTGAAAT
CTTTCCCTGTCTGTCTTTGACTCAACTGGAGAGGCTTTTGTGAAGCTTTAGGAGAGATTT
TCTTTTCTTTTTTCTGCCAGGCTTACATGATCAAATGCCTTTGGGGTTTTTAGATTATCA
CAATGGATAAATAATTTTAGCCTTGGTGCAAGAAAAACTCTTTAATCCTTAACCTGAAGA
AGACTTAAATATCACGTTCAAGTAAGAAAGTTGGAATGATATTGACATGAGGGTGGAGTG
GGCCAGACAGAGGACAAAGTAAAGATGCTATCACTGGAGGAGCTGCAGGGAACGAGGAGA
GGAGGGAGGAGATGACGGATGATGAGCAGCAGTGCATAGCTGGTGTCAGGAATGTTGCTG
CTGTTTGACTAGTTCTAGACCCAGATTTCTATGTAACCTTCCCCTATTGGGCTCCCTGTG
GGATTGGTGAAGGGCAGCCCTATTGCACTTGAGCTGTGTGTCCTTCTTCACCTCTGTCAC
CCTTCTGTGATGATGAAGGTCACAGTCTTCCCTGTCATCCCTGCAGGACTTCGATATTGA
TGTCGTGGCCGTGGTGAATGACACCGTGGGGACCATGATGACCTGTGGTTATGATGACCA
GAACTGTGAGATTGGTCTCATTGTGGGTGAGTGAATACTGGGCACCAGGGCTGGTACTGG
GCCAGGACAAGGGCTGGAATGGAAGAAGGGGGCCATGGCTGGGTGTTCCTTTGTCCCTCA
TATTTGAGGATAATGGTGTAGTCACTTTGGAGGGCTGAGCCAGCTTCATGGAACTGGGGG
CAGGAGAGGACTGTATTGGGTTGTGCCAAAAGTCCTCAGCGAGGACTCCCAGCCTTCCCA
GGCAGTCTCAGGACAGTGGTGTCAGGGGAGACGGGGTGCTGAACAGTCCTTTGCCGTATT
CAGGCACAGGCAGCAACGCCTGCTACATGGAGGAGATGCGCCACATCGACATGGTGGAGG
GGGACGAGGGGCGCATGTGCATCAACATGGAGTGGGGGGCCTTTGGGGACGACGGCTCAC
TCAACGACGTCCTCACTGAGTTTGACCGGGAGATCGACATGGGCTCTCTGAACCCTGGGA
AGCAGCTGTGAGTGGCCCCTTGCTGTGTGGGTGGGTTTGGGGTGGGCTCGGGAGCCGGGG
TGGCGTTTTTACTGTCTTACATCCCCAGGAGTTGCCAAGGTGCCCTCCGGTCGGTTATGG
GAAGATTAGTGACTATCAATTGCTGAGAGGGCTCTAAAACAGAGCTAGTGGATACACCAG
ATTATAGCTAATACTTTGGCCACGTCCTTCAAAGCAAACATTTTAGAAGTTCCTATTCTG
AGTCTAAGTCCCTGCTCTTTCTTTCTGCCCTCTATTTGTAAATTGCCACGTAAGAAAAAT
TACGTTGAGATGGCTGAGATCAGGGTCTCTGTAAGCTCCTTTTGTAGCTCCCACTCCATT
GCTGTCCAGAGGACAGGATATGACAGTTGGCTACTCATCACTGGTCCATAGGTCCCAGGG
CCTTCTGTCCCTGCCACAGGCAGACCCACAGCCTTTGGGAAGGCTGGGTAAGGAGCTTCC
TTGCCCTCTTTCCTGGACCTGTGGCCCAGTGTGTCTTTGGATGGATCAGAAGAGCGGCCT
CAGCACTTTGAGCCCTGAATGCTACTCTCCGGCCTGACTAGACTTAGTTTATAGTTACTA
TCACCTCTTACAAAACATTGGTTCACCCTTACAAACATTTATCAAATGTTCCTGTTAAAG
ATCTTGAAGCAGGGATTGCTGCAAGCTGTGAAGGCTGTTGCAAAATGTTTTGAGCAATGC
ACCCTTCTCTGGTCTTGTTGCTATGATTGTTTTAGACCTCTCAGGACAGTCTTACTTTGT
CACCCTGGGTAGAGTGCCATGGTGTCACACAGCTCACAGCAACCTTAAACTCTTAGGCTC
AAGTGATCCTCTTGTCTCAGCCTCCCAAATAGGTGGGACTACAGGCACCCACCACAACAC
CTGGCTGTTTTTTAGAGACAGGGGTCTCGTTATTGCCGAGGCTGGTCTCAAACTCTTGAG
CTCAAGCAATCCACCCACCTCAACCTCCCACAGTGCTAGGATTGCAGGCATGAGCCACCA
TGCCCGGCCTTACTTGAACTTTCTTAGGAATGTGTAGGTTGTTTCTGGCCTGGGTGGTGA
GAGGTTTACAAAACTGCAGAATCATCCACTCGATGTCTGTTTCAGTGGCACACCCAAGTC
CTTCTGAGGAACCACATGTCCTTTGAAATATCAAAAGACAAATTTGCCAGGCCATGACAG
CACACCCCAGCCTAGCCTTAGATGAGACAAGGGCTAGGAGGACGTATGTCAGATTGTTGG
CCAGGGCAGACCTGAAGTCATTATAGACAGCTTTTACCCCCTCTAATACATAATGTGTTT
TTAAGTAAATATCTTCCGAATATTGACTGGAACGAAGTGTTTTTAAACTAGAATAAAAAT
TTATAAAAAACCATTCACATCATGGAATCCTGTGGCCTCTGGGCATTCTCCCTGCCTCTC
ATAGAACTTAGCTGTGCAAGAGATGGCCCAGACACCCCCAGCTGTGCTCCCATACACTCC
CAGCTGTGCAGGAAGTTCTTTTCTGGTAAAGTCTTTTCCCGAGACCTGACAGTGTGCCCG
TGTCAGTGGGTTGACATTTTAAGTATGCTGTGTGCTCTCAGCAGTTTTGCCAACTCTCAC
CTAGCTTTGATTCTGCCATATCTGCTTTGGGTCTTGAATAAGTCACTTCCTGAGGGCCTT
GGTTCCTGTTCTATAGATTCCTTGCACTCTTCTGGTCTAGTCTCCTGGCTACACGTAGAC
TATCCTAGTCACTAGGCAGTTCACCCTTGGTGCTTCCTTTCTTTAAGACCTAGATCCTTT
CTGAGATACCCAGAAATGGGCCTTTTGCCAGGGCTTGATTTCCTCTGTGACATAGTTCTA
GCCAGAGAGACCGATTTCTAAAGGAAAACAGTACCACCTAGTGTTGAAAAGTTAAATTAC
CTGACTGCCCTCTCTGGAGGTCCTCCTCTGCCTTTCTAAGAGGCACCTGCCTGCTCAAAA
TGCTTTTCACTCCCAGATTCCCGAGACCTGACATTTAGAGTTCAGAGCTGAGCTCCCACT
CGTCTGTGTCAACCTGCCCATGTAATCTGGTCCCAGCATATCCCTGCCCCAGGTTGGATT
AGAGGAGGGAGATTCCACCATTTTTCCTGAAATCCACACCTGGACTGCAGGGGTGGGCAG
TGTGAGTTAATGAATTGGTAGGCCTGTGCCCCACATTTAATGAGATTGACTTCTTTTCTT
GTAAATATATGTTGCTGCTCTACATAAGATTTTATTTTTAAAGAGCATTTCCTTGCTAGA
GAAGAATTTTAAAAATCACTACCCTTTATGTGATATGTAATTTATTTAACCTAAAACTTA
GGTTTTTAAATGTTCCATACTCCCTGGATGTTTTGTTTGGCTGCTTAAGGCCCATTCTTC
TCTTTGGGTTCAGAGACCATCAGCTTGTAGGGACAGCTCAAGCCCCAGCTCTTCCAGCCC
CCCTGAGCTGTCACTTCTCCACATGTCTCATTCCTGGTGATCCTCCAAAAGTTAACTCTT
AGCTGTATACCAACTGCTGAAGTATGTTGAAGTTTCACATGTGTGCATCTTGCTTCCACA
GGACAGCTGTGAATTCAGGGACAATGGGGCTTTATCACCTTGGTCTGTGTCTCCCTGCAG
GTTTGAGAAGATGATCAGTGGGATGTACATGGGGGAGCTGGTGAGGCTCATCCTAGTGAA
GATGGCCAGGGAGGAGCTGCTCTTCGGAGGGAAGCTCAGCCCAGAATTGCTCCAAACGGG
CCTTTTTGAGACCAAGGACATTTCAGATATTGAAGGGTGAGTTTCCAGCCCTGCCAGCTC
TAGTCACTGAGTCTCCACAGGGTACACAAGTATTTGGGGAATGAGGAAGGTGCATTGGTG
TTTGACCCTTCAGGCATAGGTACAAGAGGGTCTCAGTCTCCACTCATGGTGCCGGGGACA
GTTGGCCGCCGTATGCAGGGATTTGGGCATGACACTGGGTTTAGTGCTGGAGGCTCTCAA
AGGGCCCTGGAGTGGCTCATTTGCATCTCCTTTTCTTTCTCTTGAAGCTATGACACCTCA
TCTCCTATTGCCAGTTCTCAAAAAGGACTATCCTGGCCCCTGCTTCACAGCAGAAAGATA
GATCCTCAGGTTGTCCAGAGACGTACCTACTCATGTAGTTCTAGTGGGTAGAAGCAAGGC
CTGCATTTTCTCAGCCTTGGCATGGGTAGGAGTGAAGAGGAGCTGACTTGTTTTTTAATT
AATAGTATCCTAAGAGTTGGGCTTCATGTGCTGTTCTTGAGCTGTCTACTTGTAGATCAA
GGAGTTCCTGTTGTTTTGAGGACCAAAATGGTGGGGAAGAGGCTGCATATTTGGTGCTGA
AAGTTTATATGACTTTAAGTGGAGACTAGTGAAGGAGANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGGGTGCTAATGTCACAGCACCAGCCCTCCATTGCCATCTTT
AAACACAGGCTAAAGCTGCGCCAGCTTCATGGTGAAATGAAGTAGATTGTGCTTTAGAGA
GAGGCACCCGGTGGGTGTCACAGCTGGATGCAAGGGGTTGAGAGGTTGCTGTGGCAGAGA
TGTTATCTGTCCACCCTAAGATAAGCAAATGCAGTGCGTGCACACACACACCCCTCAGTG
TACAATGCACCAGGAACAGGGCCTTGTCCCTTATTCAGCACACACACAAGAAAACTAATT
TTTCTCATGAGGAAAAAAGGGGTGAGGCAGGGCAGCACTGCGCGTGCGTGTACGTGGTGG
GTGGGGAAGGAGCCCCCTGATGGCTGAGTTACATTTTACCCTTCTCCTTCCTTGTTCCAC
CCCCACAGGTGAGCTGAGCAGTGAAGAGGGACTCAGCCCTCCATGTTGACGGGGTTTGCC
AGAGTCAAGGGGTTTTCTTGTCACGTCCTGCTGCAGTGGGTCAGACATGAGCCCACTTGC
TGTCTTTCTGTTTCCCAGAGAGAAAGATTGCGTCCGGAAGGCCCGTGAGGTCCTGGTGCG
TCTGGGCCTGGACCCGACCCAGGAGGACTGCGTGGCCACTCACCGCATCTGCCAGATCGT
GTCCACTCGGTCGGCCAATCTGTGCGCGGCCACCCTTGCAGCTGTGCTGCGGCGCATCAA
GGAGAACAAGGGCGAAGAGCGCCTGCGCTCCACGTCGGGGTGGACGGCTCTGTCTACAAG
AAGCACCCCCAGTGAGTCGCGTGCGGGCTGGGGCTGACAGGGCAGCCAGAGCAGCTGGGG
ACCTGGCTCCGTGGCCAGCTTTGTTTTTGCATTTTAGGGGTGATAAAGGATGGACCGTGC
AGTTGAGGATCCTGGTAGAATAAAAGTTCTCACCTGGGCCAAGAGAGAGGGTGTCACTCC
CCCTGGTGCTGATGGAGGTGACTTCTGAAGGCCATGACTCGAGCTACCCTCAGTGCTCCG
CTGGCTGCTGGGCACTGTTTTTACCACTCTCTTCTGAAAGAGTTAGTGTTTCTTCACTCT
GTCTTGATTCTTCATGGTTCCTGCAGGTGCTATGTCCTCTGCCAGGAGCAACCCCAGCCC
AGTGGGTGACCAGCCTCTCTAGCTGACCTTGGTACTAGATTGAACCTACCCTGTTCACGC
TTTGATCTCTTGGGTCATATGTACCAATACATCCAAATTTCATTTGGGACCTTGTATACA
TCTCTCTGGTGTACTCACTTACTTTCCCATATGAATGCCAGGTCACTGTGTCTTCATTAC
CTTAATTGGTTGGTGCAGAAGGTCTCAGCCCTGAGATTCCCCAATCCTAGCCCAGTGCCT
CAAAAACTTTATTATGTATGCAAGTCACCTGGGGATCTGGCTTAAGAGGCACATTCTGAT
TCAGAAGGTCTGGGGTGAGCCTGAGTCTTACATCTCTAACAGCCCCCAGGGAGGCTGTCG
GCCCACAGACTGTTACTTAGAGCAGTGAGGCCCCGGAGACCATGACTAAAAGTGGCCACC
ATCTCAAGAGGTTCTTGCCAAATGTACCGTTGTCTTTAGCTATTTAGACACCTTTGGGAT
CATTGGCAGAAACCGGTGAAAAAGATGTCAAAGCCCAGGAGAATAATTTTTTATTTTGGA
TCCTTCTCAGGACATTATCTAGTGAAACAAGTGATAGAATCAGGAATCACCTGATTCCAC
TGGGCTGTTCCAGCCAAGAGGCTGCACGTGGGCACACTATGGGAAGGGGCCATATTGAGC
CGAGGAGGTGGGGCCTGCAGAACAGCTGGATGAGGAAGGAAGGCTGTGTGACTGCATGCA
ATGGACAGTGGCTCGTTAGAAGGGTTCTTTCCTTCAGTGAGGGGTGCCCAAGCCAAGGGA
GTCACAGTCAAATATCAGAGTTTTTACAATGACTCCTACCTTGGAAAAGAGAGAGGAGAT
GTTCAGGGCAGCATCTGCTCCTGCAGGTGCCTCCTGGCATTTGGGCTGAGGTGGTGAGCT
GCTGTCTCAAGCTGCCTTTTTGAAGAGGACAACCAGTCAGCCTAAGGCTCAGGGCCCAGG
CCCCCAGTGGCCTCCTGGGTGACCAGTTTGGTGTCTGAAGCTAGATGACCTTCCATTCAG
AGGCTGTTCATTCAGCATTTGTTTGTAGATCACCGGTGGTGGGGGGACTGGGTGGGGGAG
TACATCATAAACGAGGCACCAAGAAGGCTGGCCTGTGGGGTGAGGTCTGGAAACTGGGGA
GGCTGGGATTGTCTGCAGGGGAGAGTCCCAAAGAGGTGGCCTGAAGAGGTGGCGTTTGAA
CTTGGAGTTGGGATGGCTGGGAGAACATTTCAGATCCCATTGGAGACCAGAGGCCAGATT
TCCTCCTCTGGGTATGAAAGTCCCTCTAACTTCTGTCTCTCCAAGTAGGTTTCAGGGGAC
CTGGGCCACTGTGACTTCTGTTTTCCAAGCTGGTTTCAGGGGAGCTGGGCTACTCATAAG
TCGATGGGACCCTGGACAGCTTCTCCCTATTTCCCTAGCCTCAGTTTCCTCACTTGCTCA
TAGGAAAGCTTGGATATGATCTTAGAGGTCCCTTCCCAGGTCCAGTGACTTATCAGCGCA
TGTGATTGGCCAGTTAACGAGGGAACTTGCCATAGTCCAGGCCAAAAGTCAGGATAATAG
CCATGTGCCCTTAGAGGGAACACTGAACCCTTTGACTGTTGTAACAGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATGGTGACAGCAGTGGCTTACCGGTTAGCTGACCAGCAC
CGAGCCCGCCATAAGATCCTAGAGTCTCTGAGTCTGAGCCATGAGCAGCTCCTGAGGTCA
AGAGGAGGATGAAGGTAGAAATGGAGAGAGGTCTGAGCAAGGAGACGCATGCACTGCTCC
TGTCAAGATGCTGCCCACCTACGTTTGTGCCCCCCTGATGGCACAGGTATGTGCAGAGTT
GCCCCCTGGCTTATACAGTGGGCCCCTGTCTCGGTGTTGATGCCCTGGGGAGGTTAGCAT
TAGCACTGGCCATTTTAACCAGAACATGTTTTCTCAGCTGTATTGCTAGGGAATTCTGGT
GTTTGATACATGAGACATTCCTCTGCTAAAATTAAACAGTATTAATAGTCCATACTTATT
GACTGTTTACTATATGTCAAAGTACTTTATGTGTATTAATCCATTTAATCTTTGACTGTT
AAAAATATTTGCAGTTGGCTGGGCACAGTGGCTCACGCCTGTAGTCCTAGCACTCTGGGA
GGCTGAGGCAGGTGGATGGCTTGAGCTCAAGGGTTTGGGACCAGCCTGAGCAAAAAAAGC
AAGACCCCATCTCTACTAAAAATAGAAAAACTGAGGCAAGAGGAGCATTTGAGCCCAAGA
GTTGGAAGTTGCTGTGAGCTATGATGCCATAGCACTCTACCCAGGGCAATAGCTTGAGAC
TGTCTCAAGAAAAAAAAAATCAGCAGTTAATTTTATTAACAAACTGTTATGTTTGGCAGA
AAACTGGGGCACAAAGATGTTGAGAAACCTGCCCAGGTTCATACAGTAGATTATATCGGA
GCTGGAATTCAAACCCAGAAATTCAGGTTCTAGAATCTTTTCTGGTGACCACCACATTGG
TCTGGATCAGCAAACTACGACCCATGGGCCACTGGCCCACTCCTTGTTTTTGTAAATAAA
GTTTTATTAGTATACAGCCATGCCCATTTGTCTGTACATTGTTTACAGCCTGCGTTGCAC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGTGCCTGTGGTTCAAGCGGCTAAGGCGCCAGCCTCATACACCTA
AGGTGGCACCCAGCCCGGGCCCGCCAAACAACAATGATGGCTGCAACCAAAAAATGGCCA
GGCGTTGTGGCGGGCGCCTGTGGTACCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCT
TGAGCCCAGGAGTTGGAGGTTGCTGTGAGCGTGATGCCATGGCACTCTACCCAGGGGGAT
AGCTTGAGGCTCCGTCTCAAAAAAGGAAAAATAAAATAAAATAAAAAATAAAATAAAATG
TTTCCCTTTAGTTTCCTTCAGAGAGCTGGACTCTGCCATCTTCTCTATTCTAGAATCTAT
TATAAAGTGGCTTTTGATTTCAGATGAGTGGTATGTTTGGAAAGCCCCATCTCACTTTCT
TGACTGTTAGGTAGAACTCACTATCCATCACCCACTGAGCCATCAGGGGCTCCAGGGAGA
CCCCCGTTTAGGGAAAGATGCCTTGACTCTGTCCCTCTTTGCTGTGGTGAGATGGTGGTG
TCCCAGCTCATCACCTTCCTGGGTTTATTTTCCAGAGAAAGGGGACTTCCTGGCCTTGGA
CCTTGGAGGAACAAATTTTCGGGTTCTGCTGGTGCGTGTGCGGAACGGGAAGTGGGGCGG
AGTGGAGATGCACAACAAGATCTACTCCATCCCACAGGAGGTCATGCATGGCACTGGGGA
TGAGGTGAGGCAGGTGGCACGTTGGGGATGTTGCTTTCTCTGCTTGCTTGAGACCCTGGG
GAAGGGCTTGGTAGACCTTAGACCCCAGGCTGGTCTTTGCACTTCTGGGTGGAATCCTGT
GCTCACTCGGCCCTGCTAAGGGCAGCCTGCCCTGGCCAGGCTCCTCTTTCAGTGCCTGAT
TTCTCCTGCAGCTCTTCGACCACATCGTCCAGTGCATTGCCGACTTCCTGGAGTACATGG
GCATGAAGGGTGTGTCCCTGCCACTGGGTTTCACTTTCTCCTTCCCCTGCCAGCAGAATA
GCCTGGACGAGGTAACGGTGCCTCCCTGGAGGGCTCTCCTGTGTCCTGTGGGCTTATTGA
GTCCGAACCAGTCAAGTTTGGAGGAGGGGGAAAAGAAGAGCATGAGTGATCAGTGGGGGC
AAGGGGACTCTTGATGGGAATGATTGACTCAGAGCCGGTGGCTGTTACAGAGGTTAGCTA
TAAACTTTTCAGATGGTGATGAGGATGCCACTCAAAAATGTTAACAACTGACTTTTTTAA
AAAGCATTTACTTTAAGCCAGGTACAATGTTAGTCTTCCTATGTACAATTATCTCATTTA
ACCCTCACAGCATCCATATACCGTAGGTGTTTGCATGCCAATTTTGCAGAAAGGGAAATA
AGGTCTATAGAGGTGCTGGGTATCTTGCTCCAGGTCATACAGCTTGGAAGTGGCTGAGCC
ATGATTTGAATTTGGTTTCCTGATGTTTGAGCTGTGCTTTCCTGAGGTCCTGGCTATGGG
TTGGGGGATTTTAACTTCATCTCCTGTGTGTTGTCTGGGTGCCCTGGCTTTTTCCTAGTC
TCTCCCTTTTCAACTTGCCTTGGATGAATGAAGCAGGTGGGTAGACCCTGAGAAGTGGAG
GAGACCTGAGCGGGCAGTGCTTGGCTCTGGGCTAGGATCAGCTTGCCCTCTGTATCACAT
GTCACAGCACTGTTACTGAAGTAGTCTTACCTCTGTGTGTCCGCCTTTAGAAGCACATAT
ACACACTGCAGCTGTGTAGTAGGCTGCGGATGCAGTTGTAGGGTTTCTGATGAAACAAAC
TCAGAAAAGTAAGAGCTGCTATTTGGAATGTGGCATCTGTGGGGCACTGCAGTCCCCAGC
ACATGCAGTGAGATATTAGTGTAAGCACACACCTGGGGTGGGGACATGAATACTTGCAAT
AAAGCAGAAACAATTGACGGGCAAAAAAGGTGGGCAGGCCTGGCCAGTGAGGACAAGGGT
GTGTAGATGTAAATAAGTCATAAGAAGGGCCTGGACAGGACAGGGAGCCCACCCCAGTAA
TGGGGAAGGACTGGCATCTCTCTCAGGTCCCTGGAACACCAACCCTTGAGTTGTTCCACT
GAGCTATGTAAATGCCTCCCACGCTTACCCCTATGAGAGTTCAGTTTCCCTCTAGTATAG
TTAAGGTTTCAGAAAGTCCTACAGTAAACCCTGCTCAGTCTGGTATTTCCCAGCAACTAC
TAACGTTTGTCCAGTGTCACTGGCTCACTGTGTGGTTCACGCATTGTCTTTCGCAGTGTT
AACATATTAGAATTTCAAGGCTTCATGTTCTCCAGTTTGTCAAAGAGACTTATCAACTGT
GGATAAATATTTATGTCATATTTAATAGAAAATTACTAATTATAGCAAAGTTGTTAGAAA
CAAACTTGTTCAACAGGCAAGTAACAGTTAAATAAATTATGAGCCAATTATTACCCGGTA
TAAGCTTTTAGTTCTTTGGAAAAATTTTCAGTGATGTCGGAAAATACTGGTCGTATGACT
AAAAACTTTTAAAAATATTTTTCTTTAAAACCTGTAATCTCCTGCAATATGGAGGAGTAT
AATAATATGATTAATAGAAAGAGAAAAATATAACACTTCAGCTGTATCCTTCCAGACTTC
CTACTAAAAATATTTTTAAACAAGCTCCATCTTAGATTTCATGCCAACACATGTATATCT
TTATTTATATATTTACCAATAAAGTAGAAAGCATGTTAACTGTTTCTGTCTGAATTGTAG
GATTTCTGGCCATTGTTTTAGATTTTGTTCTCTATGTTCAAAGTTCTTGTGAGGAGCATG
TGTTAAGCCTAGAATCATAAAAGTTAAGAGGAAATGAAGCTGAAGATAGTTCTGTCTGTT
GGCTCTGGCGAGCTCATCCTGATGATGGGGAAATCCCCAGGCACGGAGTGGGGCCCAGAG
GCCACCAGCTCTATTGACAAGCCACCGGTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAATCTCTCAGACTTAT
GGCTCAAGCAGTCCTCTTGCCTCAGCCTCCTGAGTGGCTGGGACTACTAGTGTGCACCAT
AATGCCCGGCTAGTTTTTTTTTTTTTTTTAATTTGAGTAGAAACAGGGCCTTGCTCTTGC
TCAGGCTGGTCTCCAACTCCTGAGCTCAAGCAATCCACCCACCCTAGCCTCCCAGAGTAC
TAGGATTATAGGTGTGAGCCACTGTTCTTGGCCTTGTAAACTTTAAATTGCCAAATCAAA
ATTTTGTCATATATGAAACTGACATGTAGACAAGAGAGACAGGCGAAGGTAAGCAAACAC
TTGTCTGGCTGTGGGCATTTAAACCAGCACTCCAAGGGAATGTAGTAGTACTTTGTCTTC
TGGCTCTCCTGGGATCTGAACATGGCATTACACATCCATGTTGATATGAATGAAAGGTCT
GGCTAATGGGCATAAGTCACCAAGCAAGGCCGAGAGAAACCAGGCCGGGGGCAGGTGGTG
AGCACACAGCCCATGGATGGAGGCTGACCTCTTGGGTAAGGAGCCTGGGAGGCCTGATGC
TCATTTTCCAATGGGCTGTGGTGAGATCAGCCCAAAACATTTCTCCCATTGTGCATCTGC
TCCCAGAGGGCCCCAGAACATGGTAAAGGGGTGTATTAAAGATAGGGGGCCACAGAGGAT
TCCAAGGAGTAGCCTGGGTGCTTTCCTCACTGAGAAACATGTGTGAAGCCTGGTTATTAC
CCCAGCTACAAGCAGGATACTGGATCACCAGATACTGGAGTTTGAGAATAAGAGACACAC
ACTGAGCCTTCTGCTACAAGTGAAGGAGAGGGACAAGGCAAACTGCTCTGCCTAGTGAAG
AAGCTCAGTATATAGGAATAAGTCCCATAGCAAGACAGCTTCATGGTGCCTGTGAGCCCA
TTCATCAGGTTAGCGGGCCTGCTGGGAGTTCTGCTTCTCTGGCTTCTGTCTTGCTAGCTA
CAGGCCTTGGGCAAGCTACTTCAGAGCCTTAGCTTCTCTTAAAGCAAGCATGATAGTGAT
GATTGTTCCACAAGGTGCTGTGAGGATTAAATGCTGTAACACACAGGGTGTGCTAAGCTC
AGTACCTGGTGCACAGTAGGTGCTCAATTAATCTACCCACCGATACTTTAAACTCAATTG
TGCATGAGATTTTTGGTGACTCCAGGGAGCCTGATCTGTGAGGCTGAGAGCTAGAAGCAC
AGCTGGGCCCCACGTGTGAGTGGGGAATCCTCCTCTGATTTTCTTTCCATGCCTGTGTGT
GATTTTTAGAGCATCCTTCTGAAGTGGACAAAAGGCTTCAAGGCATCTGGCTGTGAGGGC
GAGGACGTGGTGACCCTGCTGAAGGAAGCCATCCACCGGCGAGAGGTAGGAGAGCTGTGG
CACCAGACCTGATGTGTCAACTCCCAGATTCCTCACAGAGCCTGGGCATTCAGAAAGTGG
GGCCAACATTAAGGGCAGTTGCATTGGTTGGGAGGAACATCCACAATTATTGAGCATCCA
CTGTATGCTAAGCCATTTCAGCACTGTGGCTTCAGGGGTGATCACAACAAAGTCTTATTC
TGTAGCTTATTAGGTCCTAAGAGCTCTGATGAGAAGTGGAGGTGGGTGAGGAGAGCAGGT
AGAGTGTGCTGGAAAGGGCTCTCTTACATAGCACAGCCAGGAGGGGCTCTCCGAGCAGGC
AGGGTTTGAGTGGAGACCCGAGTGAAATGAGAGAATGAGCCAGGGCTATGAGAGATAGTT
GACACACGTCTACATCGCCCTTACAAATGCCTGCAAGGAGTACAGTGGGCTCACTTGTGG
ACTAGGCACCTGCTTCTGCCCTCTCAGGAGTTCGACCTGGATGTGGTTGCTGTGGTGAAC
GATACGGTCGGGACGATGATGACCTGTGGTTACGAAGACCATCACTGTGAAGTCGGCCTC
ATCGTTGGTAAGGACCGGGACGGGTTCCTGCGTGGGGAGGACGGCCTTGTCGGGAGGGAG
GAGGATGGCGCTGAGCAAGGCCCTGGCGTCCTGTGCTTGGCAGGCACCGGCAGCAACGCC
TGCTACATGGAGGAGATGCGCAACGTGGAGCTGGTGGAAGGAGAGGAGGGGCGGATGTGC
GTCAACATGGAGTGGGGGGCTTTCGGGGACAATGGGTGCCTCGACGACTTCCGCACAGAG
TTTGATGTGGCGGTGGATGAACTTTCCCTCAACCCTGGCAAGCAGAGGTAGGCACCCAAC
TGTGTGTGGGCCCCACTCCGTGCATCCCAGATCCGAACTGAGACGAGTGAGTGGAGCCCT
GACACAGCGTCTCCTGGGATGCCCTTGGTGTTCATAGAAGAGGTTTCCTTGGAAAGCATT
TCTTACCAAGTACACTGGAAAGTTCCAAATTAGTAGTTAATGTGAGAAGCAGCTCCTACG
CCGAGGACTGAAAGAACAGGCAGGCGAGCACTAAAACTGGGTCTGAGGCTGAGGAGAAAG
AAATAGAATGGAACCACTTGCTGCTACCGGGCTGAGCATCTCTGCTGAGCTGCCCAGACA
GGAGCAAATCCTCCCTTCCGCCTTTGTCCATCCGGCGTCTAGCGCCCTCTATTGTCAGAT
CTGAGCAAGGGGCCCGCCCCGCCTTGCAGAGCCCTGTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGGAAGCAGACTAGGGGTG
GCTGGCTGGCTATGGAGTCTTGAATGAAATCAGAGACCTTGGCATTTTTTGTTGTTGTTT
TCTTTTTTTCCAAGACATCATGCAGAGTCTAAAGACCCTTAAGCCACTGCATGGTCGTGT
TTAGTTCCAGTAGCCAGGAGAGGGGCTCTACAATGTGCACTAGTTACTGAGTAATAATGA
CTAGGTCTAAAAGAGTGCATGCTACATGCCTAGTGAACTTAGGGGTAAGACTCAGCATCC
TGCCCTGCTCCCAGGAGTGTGGTTGAGTTTGGAGTGTGTTCCTTCTTGAGGGCTTGAAAA
GCCTTGGAAAGGAAATGAGATCCTGGAGGGCAGCATGGTCAAGTTTGCAGAAGGTGGTAG
ATTAGCATACAAGGACATTAGGAATGCTGCCTAAGTGAATTAAGCAACATTTCCTTTCCT
GCCAGGGGCAATCTTCATGCCTTCTGCTTTCTAATCCTTTGGGGGTGCCCAAGCTGGCCT
GTGCCATCTCAGCATCCCTTACCACCTCCCTACTTATCCTCCATGAGCATTACTGTCATT
GTCATTTCATTCCAGGTTTGAGAAGATGATCAGTGGGATGTATCTGGGCGAGATTGTCCG
GAACATCCTCATCGATTTCACCAAGCGTGGGCTGCTCTTCCGAGGCCGCATCTCAGAGCG
GCTCAAGACAAGGGGAATCTTTGAAACCAAGTTCCTATCTCAGATTGAGAGGTGAGAGTT
TAGGGCTTAGTGTAGGGTGTGGCTATGTCCTCCTCATGGACAGTCGAACTGAAGGATTTC
CATAGCTCAGATAAGATCAGGGCATGGCTTATGCAAAGATCAGTTTCGTGGCAAACGCAT
TTATGTCTAGAGTGTTTGCTGAAGCACCTATGGACAACTGTCATATTAAGCGCAAATATA
TAACATTCTCATGCTCATGCTAAGTGTGCAGGGGAAGAGTGGCACAAGACCATGCAAAGT
GATATTGTTGGGCTTCAGACTAAACATCAAAGGTTGAAAGCTACCTGCTGGTAGGATGTA
AATTGAAATTCACAGAATAATTAAGCCATCCACACTGGCTTAAAGGGCCTTCCTAACTGT
TGGGCATAGTGATCAGGCAACAAGGATGGATAAAAGGTTGGAAGGTCAGGCAGTGCAGAA
CATGCCATGTGGAGACTCATTAGAGCAAAGCTTCCCTCCTCCAGTCTAATGGCAGAAAAG
TCTGCTCCAGACTAGAACAGTGAATTGCAAAGCCCATTAAAAATTAATGCTGTGTCATTA
CTCCCAGTGCATAGTAAAATAGGTGCTGGACAACTGGCCTGAGTGGGCCCCTTGGGCAGC
TGCACTAGTGTACAGGAATAATATGTTCTAGTTTGCATGTTTGTTTGTGTGCAAGGAGAA
GATTCCAGACTTCTAAAACAACTCCCTTTATATGTATGATAGGGTTTACTTTCTTCCTAT
AATTCTATTTACATTTGTTTCATAAATAGCACACACGTAGAGTTCAGACCACTCAGGGTG
GCAGAGTAGAAATAGAGCAGGTGTCAAATGCTGCTTAGTGGACCCATGTGTCCTGTGACC
CATGAATTGCAGTGAGATAATGGACAAGAAAGAGCTTTGTAACTGGAAACTGACGTTATC
ACTGTCATTATTATTTCCAGCTGAGTAGCATACATAGTGAATTTCCTCCTGAGTGTCCAT
TTTGCTGTAGCAATGTCCTACTTTGTGTAGGGAGATGTTTCTTTGCATTCCTGTCACCCT
CAGGAAGAGTGCAGGGGATTGAATGCTGATCTCAGTTTAGGAAACGGAGCCACCTCGCAG
AGCCAGCTGTGGAGGGGTGGACCCCATGGAGCCAGTCCCTGACGTGGTGAGCCACCAGCT
CTCTTGCTGCCTCACTGACCGCTCACTGTCTCCCTTTCACCCCAGCGACTGCCTGGCCCT
GCTACAGGTCCGAGCCATCCTGCAGCACTTGGGGCTTGAGAGCACCTGTGACGACAGCAT
CATTGTCAAGGAGGTGTGCACTGTGGTGGCACGGCGGGCAGCCCAGCTCTGTGGTGCAGG
CATGGCCGCTGTGGTGGACAAGATACGCGAAAACCGGGGGCTGGACACTCTCAAAGTGAC
AGTGGGTGTGGATGGGACCCTCTACAAGCTCCATCCTCAGTAAGTGCCTGACTCTGGCCT
TCCCTACCTATCCTCCTTCTCACGTCTCCTTCTCTCCTTTCTTATCTTATGGTGAATTAT
CAGCCATTTCAAAGAGTGTATATAATATATTTATTATAGTTTAAAGATGACTAGCCAGCA
GTAGGCTGAGTTTTACCCTCATCATCAGAAGCTTCTATGAGCCCCTTCCAGTTATACCTC
ACTGTCCTCTGCCAGGGGCAGGTGCTGTGTTGAATTAGCTCCTTGCTTTTCTCCTCCCCC
CAAATGTAGATATATACCTATATTGTTCAGTTGCACTATTTTTTTTTTAATGTTACCATC
CATAGAATTGTGTGATATCTCTTCTGTACTCTCTCACATAATGTGCATGTTCTGAGATGC
AAGTATGCACTTACAGTTCATTAATTTTGGGGGCTATGGTGGGGCACCCATGCTCAGTGG
TTAGGGCACTGGCCACATGCACTGGGCCTGGTGAGTGCAAACCCAGTCCAGGCTTGCTAA
ACAAACAAATAACAACAGCAACAGCAACATCACAAAAATAGCAGGGCATTGTGGTGGGCA
CTTGTAGTCCCAGCTACTTGAGATCACTTGATCACAAGAGTTTGAGGTTGCTTGTGAGCT
ATGATGGCACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACAGTCAGT
GAAAGAACTCAGAAGTTCTAGATCGGCACGGCACTGTGCTCAAGCGGCTAAAGCGCAGCC
ACATACACTAAGTGGCAGGTTTGAATACAGCCCAGCCCGCCAACAACAGTGATGGCTGCA
ACCAAAAAATGGCCAGTCGTTGTGGCGGGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGA
GGTAGGAGACTGGAGGTTGCTGTGAGGCTTGGGAGGCTGAGGTAGGAGTTGGAGGTTGCT
GTGAGCTGTGATGCCACGGCCCTCTACCCAGGGGGATAGCTTGAGGCTCTATCTCAAAAA
AAAAAAAAAAAGGAAGTTCTAGATCCCTTTGTTGAAGGGTCAGTGTCATTGTACCAATAG
GAGCCTCAGTCCCAGATGAGGATTAGGATGGGGACCTAGGACTTGGCATCCTCAGCTTCA
CAGATGGGAAGGGCACCCTGACCCTGCTGTGGTGGGTGGATGGTGACAGCTTCTTACTCT
AGTCTCATATGGAGGGGATCTGAGATCACTGTAAGGTCTTAATAGTAACTCTGTTCAGTC
TGCTTCTTTTGCCTTCAGTGACACTTAGGAATAGATGTGGAACTGATGTAGGGCAATACC
CCTGGAAAACATAAAATGAGATTTATGGGTCTTGGTCCTCCCCTCTGGAGCTTGTGAATG
GATTATGTACCTCTGCAAGGCACACTTGTAGCTTCCATGACTGTTGAACTTCTCTTTTAC
TATTTTTTTCTTCTAGAATCTGAAGTTTATTTTATTTATTTATTTATCTTTTGAACTTCT
CTTTTACTGATTGGTTTTAAGAGCCCAATTTGCAAGAATTGCAAACATGCCAAAGTTGAA
TCTTAGCTTCCCCAGTTGCCTCGTGTGATGGATTGGGCAATATTACTAGTATCTCCAAGC
CTTGGTTTTCTGGTACATAATACACAGTAAATATTTAAAACATTGTGACTGTCATCCATT
TCCTCATCTTAACTGTTGCTGAGTTTTCAGCATCCCTTCTGAGGGTCACATTTCAGAGTA
TACAAGTTAAACATGACTAAGATGGTTTTTCCTGTGTCTTCCTCCCACCTTTTCCAGCTT
TGCCAAAGTCATGCATGAGACAGTGAAGGACCTGGCTCCAACATGCGATGTGTCCTTTCT
GGAGTCAGAAGATGGCAGTGGGAAGGGGGCAGCTCTCATCACTGCCGTGGCCTGCCGCAT
CCGTGAGGCTGGACAGCGATAGAACCTCTGAAATCAGAAGGGACGTCCTCTTGCTCCTCC
TCCTCCCTGTTTTAAATTACAAGGTGTCATCCCCTTGTGTCAGAGACAGACCCTTAGGCT
TTTCCTTGGCAGAGAGGACCCTGTTGAACTGGGTTTTTTCTTTGCCTATATTCACTATAC
AATTTGGTGCCCGAACTATGGCCTTCCAAGATAAACACAGATTGAAGCAAGGATTTGTTC
ACAGTGGTCACAACCATTCTCATTGGTTCTTTTAAAACTTAAGAATGTTAACCCTTAATA
ATTAATCCCCTTGGCCAAATTCCATGTCCCTGCATAATTCTACAGGGTGGGGACATTAAT
GAAGATATGGTTGCTTCACCTTGGAGCCTGAACATGACATTTCTGGGTGGAGAGCATCCC
CCACCGTGATGTTGATACTGATCTCCTGTTGAAGATCTGGGAGGTCTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCTGAATTGGCCTCCTTAGTACATCAGTGTGGTTAAAGATGGAA
GGGGAAGATACTGACTAGTGACTAGAAATACCTCATTCGCCTGTGGGAAGAGAAGAGAAA
CT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 61851..62013, 80827..80975, 85468..85587, 86667..86762, 87346..87445, 87723..87906, 90540..90695, 91938..92130, 92133..92170, 94622..94720, 94823..94910, 94913..94969, 94972..95010, 95013..95025, 96875..97023, 97211..97330, 101049..101144, 101607..101706, 101803..101986, 103155..103310, 104505..104738, 106737..106881
1001..1063, 61851..62013, 80827..80975, 85468..85587, 86667..86762, 87346..87445, 87723..87906, 90540..90695, 91938..92130, 92133..92170, 94622..94720, 94823..94910, 94913..94969, 94972..95010, 95013..95025, 96875..97023, 97211..97330, 101049..101144, 101607..101706, 101803..101986, 103155..103310, 104505..104738, 106737..106878
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved