Otolemur_garnettii Locus TSR1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii TSR1
Otolemur_garnettii
TSR1
GeneScaffold_4500
SNORD91
22376..22467
28248
GGGCGCGCGCCACGGGGGTCGCTGTCATGGTAACGCACCTGTTCCCGCCTAGAGGGCGC
GAAGCCGCATTGTGAGCGCCTGCAGCCAGCTCGGCACTGCTCTCCTCCTGGCGGACACTG
TACCCCGAGGCTCTGCTTCTGGGGAAAAGTCACTCGCGCCAGGGCGGGCCTCAATCCAGC
TAGATGTCCTCAGACTTCTACCTGCTTGTTTTCCGACGGGAGGTACAGAGCAGGGAGATG
AAAGGGCTGGGCCGGGACACTGGGTCCCCTGCAGCTCTAGCCTTCTCACGGGGAAGCCAG
CATTCGTCGCCTGGCGTTCTCCTACCCAGCCGTCGCCGTTGAGTTTTAAAGTTTGTGGGA
AGAGAAGCATGAGGGTCACAGCTTTCCCCCCGCCCCCTTGGAGTCTCCACGTCTCGTCTG
GCCGTTCTTGCTGCTATGTGGGTAATGACAGCGCGGGCTGGAGTAACAGGGACTGGCGGG
AACATATACGGAGCAAGTTAAGGTGGGAGAATTCTCTTACAGCAATTCGCCTTAGAACTT
CACCAGCCTTATAGGGAGTTGAGGGAAAGGTGGTTCGGAGTGATAACATTTGCATTTGGA
AATTGAAAAGCTGCATGCCCGAATCTGCGTGAGAGCGAGAGACGGTGGCCTCTTCCCCAC
GGAATCTCTCATTCAGCATCTTCCTACGTGATGCAACCTTACATCGTAAAAAATAAAATA
TAAGGGAGCAAAAAAGAGCTCTCTTGGATCGAAAGCCCTTCCCGGCGAGTCTACATCCAG
CGTTTTAAAGTTCCCAGTCGCAGACTGCGGCGTGGGAAAAGTTCCCACCGCAGCTTTGCA
GAGGGGCGGGCGCGGAGCTCTTAAGAGCTGAAGGGAAGAGACCCTCGCTAGAGGGCGCCG
GGAGCCCGGGCCGTCAGGAAGAGAGCCCGCCCCTTGTATGGCACCGGAAACGCTCGGCCT
GGCCCGGAAGTGGGGCTGACTTGGTGCACGCGAGCCGCAGCATGGCGGCGCACCGCTCAG
GCCCACTCAAGCAGCAGAACAAAGCCCATAAAGGCGGGCGGCATCGGGGTCGGGGATCCG
CACAGAGGGACGGCAAGGGTGAGAGATAGTAGGAAGAAGGGCGTTTTAGCTAATATTAAC
TTCATCCCCTTTCCCAGACTGAGCTGTCGTCTCAGCCTAGGCGCCACACGAAAGGCCCTT
TCTCAGGTGGGCGTAGAGGGACCTCTTTTTTGGCCTGGTACTGAACACAACAGCCCCTTC
TGATCTTCCCTCCAGGCCGCCTAGCACCGAAAAGCCTAAGCAAGAAAGTGAGAAAAGAGC
TCAGCAGAGTAGACCAGAGGCATCGCTCCAACCAGCTCCGAAAGCAAAAGAAGGAGGCGG
TAAGAGGAGCTGGGGTTGAGAAATGGTGCAGCTTTTCACCCGTTCTAGGTGGGTAATGCC
TCGAACGAGACCCAGGGAAGGGGCCAAGGACAGAGAATAACTCTAGAGCACATGTCCAGC
GTGCAAGTCTAGGCTCGCTAGGGCACTTTTTGCTTTGGTCAGAACTTGTGCGAACCGGCT
GATGCATGATGGAGGAAATGGGCATCAGTGCTGTTGGAAATGCAGTACTGGATCACAGTT
CTGAGACATTGAGATGTTTGCTAATCTTTTCCATTCTCAGGTTCTGGCAGAGAAGAGACA
GCTGGGCAGCAAGGATGGCCCTCCTCATCAGGTACTGGTGGTGCCCCTGCACAACAGGAT
TTCCCTGTCAGAGGCCTTTCGGCTGCTTCAAGACAGGGACAGTGGAATGGTACACTTGAA
TGAACGAGGAAGCACCCATACTTTTATGCTACTATGTCCTCGCTTGAAACATCGGTGGTT
TTTCACATTTGCAATGCCAGGTTAGAATATACAACAATATTTTCTATTATTTGAGTAGGG
ATAGTTGTTTTTGAGTATTATAATGTGTTGCTGCCAACCATCTATTTGTTTTCTGTCTCC
AGGAGATCTCCACACAGTGTTAGACATGGCTAAAGTAGCTGATACCATCCTGTTCCTCCT
TGATCCACTAGAAGGCTGGGACAGCACCGGGAATTACTGCCTTTCCTGCCTCTTTGCTCA
GGGACTTCCCACGTATAGTAAGTGAATGGCATATTGGAGTCTGGGAAAGTAAGTGAATTA
GCAGTTATTGAGCAGCTGTGATTTACAGTGTGCTGTGATGAGTTGTTTTTAACTAGTGGA
GTATACCTGTATGGATTAAGCTTGGTCCATTGTTTGCAAATTATCAGTCAAGGTGCCTTT
TTTTTTTTTTTTTGAGATAGGACCTCAAGCTGTCCCCCTGGGCAGAGTGCCATGGCATCA
CAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCGAG
TAGCTGGGACCACAGGCGCTGGCCACAACGCCCGGCTATTTTTTTGTTGTTGTTGCAGCT
GTCATTATTGTTTGGTGGGCCCAGGCTGGATTAGAACCTGCCATCTTGGGTGTATGTGGC
TGGCGCCTTAGCCACTTGAGCCACAGGCACTGAGCCAAGGTGCCTTTTTATTTCTGGGCA
GAGAAAGAAGATAAAGTTTGATTTCACTGAAATTCTTTCATGGTAGTCAAGTATTAGGTT
TCCCAGTGATCTTTGGGCTTACAACTGAGCTGTTAGGTTGTGAAGTAGGGGGATTTTCAT
GTAGTGAATCAATATGTCATGAAGCCCTTTCTCTTTTCCTTACAGCACTAGCTGTCCAAG
GGATTTCTGACCTCCCACTGAAGAAACAAATAGATGCTAGAAAGAAACTAAGTAAAGCTG
TGGAGAAACGCTTTCCAGATGACAAACTCTTCCAGTTAGACACTCAGCAGGAAGCAGGGA
TGCTGCTCAGGCAGTTGGCTAACCAAAAGCAACGGCATCTTGCTTTTCGAGATCGACGGG
CCTACATGTTTGCCCATGTTGCTGATTTTGTGCCTAATGAAGAGAATGATTTGGTGGGCA
CCTTGAAAATTTCAGGCTATGTTCGTGGGCAGACTCTGAATGTAAATAGCTAGCTACATA
TTATTGGACATGGTGATTTCCAAATGAAACAGATAGATGCCCCCATGGATCCATTCCCTT
TAAATCCTAGAGTAATTAAATCTCAGAAGGACTCGTACATGGAAATGGAGGTAAGGCTGA
TATTTTTTAAAATCATGTATTGTAGATTGATACATAAGATGATACAGGATGGAAACTTAA
AATTCAGGCTTGGCACCTGTAGCTCAGTGAGTAGGGTGCCGGCCACATATACTGAGGTTG
GTGGGTTTAAGCCCAGCGCAGGCCTGCTAAACAACAATGACAGCTGCAAACAAAAAATAG
CTGAGTGTTGCAGTGGGCACCTGTAGTCCCAGCTACTAAGGAGGCTGAGGCAAGAGAATC
ACTTAAGCCCAAGAGTTTGATGTTGCTGTGAGCCATGACGCCAGGGCACTCTACCGAGGG
TGACATAATAAAACTCTGTCTCAAAGGAAAATAAAAAAAGAAACTTAAAATTCAAAGAGA
GTAGTCTGTACACTAACACCAGTAAGGGGACCTAAGGCAATAGTCAACTATAGATGTATA
GATCGATCACATACTTATGCAGCACTTTTAGGTACCACACACTAAAGTTGGCTCTGAGTT
TATAAAAGACACAAAAGATATGGTTGCTTACCTTAAATAATTGGATCAGAAAAATAGTGC
AGAATGAAATAAAATTTGAGGTAGAATACAGTTAAGGTACAGATAGACCTCCTGTGGAAG
TTAAGAAAGTAGACTAGTGACCTTCACAGAAGAGATCAGATTTGAGCCAGGTGTTCAGGA
TAAATGTGATTCATGAGTTGAAGAGGGATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCAAGGTGTGGGGTTCGAATCAGCCCAGGCCCACAAACAACAATGATGGCTTCAACC
AAAAATAGCTGGGCGTTGTGGCGGGCGCCTGCAGTCCCAGCTACTTGGGAGGCGGAGGCA
GAAGAGTCACTTGATCCCAGTATTTGGAGGTTGCTGTGAGCTGTGGTGTCACAGCACTCT
ACCCAGAGTGACAGTTTGAGGTTCTGTCTCAAAAAAAAAAGAAAGAAACAATATGAAACT
AGGCACATTGACAGATGAAAGATTTTTGTGAACTTTGCAGCATTCAAGCCTGGTGCTGTG
GCTCACACCTTACAATTCTAACACTTTGGGAAGGTGAGGCAAGAGGGTCACTTGAAACAA
GGAGTTCAAGTAACATAGTAAGACCCTGTCTCTACAAAAAGAAAAATTAGCCAGACTTAG
TGGTGTGAACCTGTAGTCCCAGCTAGTTGAGAGGCTGAGGCAGGATAACTTGGACCTAGG
AGTTTAAGACCAGCCTCAGCAACATAGTGAGTCACTGTTTCTGCAAAAAAATAAAAATTA
AAAAATTAGCTGGGTGGGGTGGCACATGCCTGTAGTCCCCGTTACTTGGGAGGTTGAGGT
AGGAGGATGGCTTGAGCCTAGGTATTATAGGCTGCAGTTAGCTGTGATCATGCCAGTGTA
TTCTAGCCTGGGTGACAGAGCAAGTTGATATTTCATCTCTTTTTTTTTTTCTGGTCTGGA
GCTGGGTTTGAACCCGCCACCTCCGGCGTATGGGGCCGGTGCCTTACTCTTTTGAGCTAC
AGGTGCCACCTGCAAGTTGATATTTAAAGAAAGGGGGCGGGGGGGCAGAGTTGGGCAGCT
CCTGTGGTTCAGTGGGTAGGGTGCCAGCCCCATATACCGAGGGTGGAGGGTTCAAATCCA
GCCCTAGCCAGACTGCAACAAAAAATAGCCAGGCATTGTAGCAGATGTTTACAGTTCCAG
CTACTCAGGAGGCTGAGGCAAGAGAATCGCCTAAGCCCAGGAGCTGGAGGTCGCTGTGAG
CTGTGATGCCACAGCACTCTAATGAGGGTGATAGAGTGAAACTATCTCACACACACAAAA
AAAGGCAGAGGTGTAGAGACTTAAGTAATGCCTCAGAAATTAGAAAATAACCATTTGGAA
AATTTTGGCTTGTTTCGTTCACCTACATGAGAATTAATGATTTGGGATCTTTCTGGTTAC
TGCATTACATTTAGTTGATTTTTGGTTAATGTTTGACTAATCACCTACTTTTGGTTTTCA
GATTTGTGCTGTGGATGCTGTAGCTGATATGGAAGAAGACCTTAGGGTTCTAGTGAAGGC
AGACCCTGAAAGACACGAATCCTTGCAAACAGAGGCTATTCCAGATACAATGGAGGGGGA
GCAGACCTGGCCCACTGAGGAGGAACTGAGTGAGGCAAATGGTTGGTATTGGCAAACTTG
TTCTTAATTCATGCAGCCTAGAACAGTGAATTTTGTCTAGCTGCTCACAGTGAGGATCCT
ATAGACTGGAGTGAGATGAGGATATAGTTGAAGGTTGTAACTTCTCCTTGACCCAAATAT
TTTGTGTTTACACTAAGCAAACATTGGACACAGCTTTGCTCCATTTCTCAAGATGACTTC
TGTTAGGCCAGGTGCAGTGGCTCACTCCTGTAATCCCAGCACGCTGGGATGCTGACCCAG
GTGGATTGCCTGAGCTCATGGGTTTGAGACCAGCCTGAGCAAGAGCGAGACCCTGTCTCT
AAAAAAATAGCCATGACTTGTGGCAGGTACGTGTAGTCCCAGCTACTTGGGAGGCCGAGG
CAGAGGATTGCATGAGCCCAAGAAGTTTGAAGTTGCTGTGAGATAAAGACACCATGGCAG
GCCGGTACAGTGGCTTACGCCAGTAATCCTAGCACTCTGGGAGGCTGAGATAAGTGGATT
GCTTCAGCTCACGAGTTCAAGACCAGCCTGAGCAAAAGTGAGACCCTGGCTGTAACATAG
CCAGGCATTGTAGCAGGTGCCTATAGTCCCAGCTACTACTTGGAGACAGAGGTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGCCCAGCCAAAACTGCAAAAAA
ACTATCAGATTCTTTACATGGTTTATTTAGCTGCATAAGTAGTGCTAGTTGTGAAACAAG
TGAATTAAATTTGGAAGTAGTTCTATTCATAAGGTCGGCTAGAGATTTCTGTGTTGATAG
CAGTATTCTAGGGAGTTAGTTTTTATATGACTTGTGTTTTTTAATGTTTGGTGGTGATGA
GAGAATGAGGAAAACAAAGACAATAGAAAAAGAATAGGATTGGGTGGCGCCTGTGGCTCA
AAGGGGTAGGGTGCCGGTCCCATATGCCGGAGGTGGCGGGTTCAAACCCAGCCCCAGCCA
AAAACTGCAAAAAAAAAGAAAAGAGTAGGATTGACCTACCTGAGAATAACCAGAGTAATA
GGGGAAAGGTGGTATATGTTAATTGTTTAATTTGTTTGGGCTTTTACAGTGAAGGAAAGC
TCCAGAGTGGTAAAGAAGGTCCCCAAAGGAACATCCAGTTACCAAGCTGAATGGATTTTA
GATGAAGATGGTGGAAGTGGTGGGGAAGGAGATGAATATGATGCTACAGAACATGAGGAT
CTCATGGAAGAGGAATCTCAGGTAAAGAAATGGGCCCTTAGGGCGGCACCTGTGGCTCAA
GGAGAAGGGCTCCAGCCCTGTATACTGGAGGTAGAGGGTTCAAACCTGGCCTTGGCCAAA
AACTGCAACAAAAATAAATAAATAAATAAAATATTTAAAAAGAAGTAAGAATCTCTTAGA
AATCTATATTTGTTGGGAATAGGTATCCAGTAAAAATATTTTTTTAGCTTAATGGCTTTT
GTGATAGAGACAAATGTGAGTTTTTTTCTGAAATAACTATAATCCCTTTATTCCATAGGA
TGAGAGTAGTGAGCAAGATGAGGAGGAATGTGAAACTATGACCTATAGGGGAGTCTGTAC
GTGATGATCTGTATGATGAGAAAATAGATGAAGCGGCTGAGGAAAAAATGTTGGAGAAAT
ATAAACAAGAAAGACTGGAAGAGATGTTTCCGGATGAAGTGGACACCCCCCGTGATGTTG
CTGCTAGAATTCGGTTTGTCAACAAGTCTAAATTGAATCAATAAGTTTTTATTTAAAACT
TGTTTGGCTTAAAACTCTGTCACTGTGATACAAAAGAAGAAAAACACGTTGTTCTTACTT
CTGAAGGACTAATATTTTGTATCAGAAGTTAATATATACAGGAAATAATATATAATTAAG
TTCTAGAGTGGTATAGACTAATGTTATAGGACTTTAATGAAGGCAAATACTTCTGTAGGA
GCTAATTAATATTCAATTGAGGTATATAACCTTAGGAGGTTTCGAGGGGTTTGCATTGAA
CTGCAAAAGCACGAAGATGTAGAAGATCACATCTGCTCTGGAAGTTAAGTCTGACTAAAA
CCATAGAGTTCATGCTGGGTATCAGAGAGGAAGGACTATGCCGTGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCTCATAGCACCTCCAACTCCTGGGCTTAAGTGATTCTCTTGCCTCAGCCTCCC
AAGTAGCTGGGACTACAGGCACACACCGCAACACCGGCTATTTCTTGGTTGTAGTTGTCA
TTGTTGTTTGGCGGGCCCAGGCCGGATTTGAACCCACCAGTTTTGGTGTATGTGGCTGGC
ACCTTAGCCACTTTAGCTACAGGCGCCAGGCCAACCGTAGCCATTTTACAAGTGACTGGA
GTGTAGCACAGCGGTTCTCAACCTGTGGGTCGCAGCCCACAGGAACTGTATTAAAGGGCA
ACTGCATTAGGAAGGTTGAGAACACTGATGTAGCATCATATAAATCTGACTTGATTTTCT
TTAAAATCTATATTCTAGATTTCAGAAATACAGAGGCCTCAAAAGTTTCCGGACATCTCC
ATGGGATCCTAAGGAAAACCTTCCTCCAGATTATGCTCGGATCTTTCAGTTTCAGAACTT
TACTAATACTAGGAAAAGCATCTTTAAAGAGATTGAGGAAAAAGAGGTTGAAGGAGCTGA
GGTATCTACCTTCCTTTGTCCATCTAGTCCAAAAGCACTAACATTTGCTTTTGTCAGTGC
ACTCCCTAAGCACTGACATTTGCTTCTGTCAGTGCACTCCCTATTTCACCCCTCTTGGTA
TGAGAATGAAGTACCTTTCTTAGTTTTGTGTTGCCCTTAGATGAGTTAGAGGGGACACTG
AGTCATCTGTAAGAGGAAGAGTAACATTGGGAACAAAGAGGTATAAAACATGTTAAGGAA
AAAAGGTGAATACGGGTAACTAAAGCATTTTGAAGGACAAAAGGGTTGACTTTAAAAGGT
AACCTGAGAGGCTTGACACTTTTATCATTGGAGAAATCCTTCTTCATTATTGGAACTTTT
AAGAGTAACTTTATGATTGTTTTCTGCTTTCTTATGGCAGGTCGGCTGGTATGTCACACT
TCATATCTCTGAAGTCCCAATCTCAGTGGTAGAATACTTCAGACAAGGAGCACCCTTAAT
TGCATTTTCTTTGCTACCTCATGAACAGAAGGTAAATTAGTGTCTTGTGGGAAATAAGGC
GTTTCAAAACTTTGCAACCCACTTCTGTCTTGAAAGTCTAAAATTCTGTTGATGTGACTG
CTACTTTGCTTATAGGGATGTGGAAATTCTGCCTCTATGATTAGGAATCACGATAGTAGA
GAAGTCAATGATGACTTTGAAAAAATGTCTGAACCTGTCTGAAGCATCTCAGTGATGCAA
ACCTTTTGTGTCTGAGACTTCTCTGAGATAAGTCTATTTTCCAGATCAGATTTTAAACAA
GGGTTGGCAGCCCTAGAAATAAAGATGTATGCCAAGGTACAGATCTTTTTTCTCTTAGTG
GGCAATACTTGTGTATGTTGAGGGGTATAACAGGTGTTTGGGTCAGTATGGGTAAGGAAG
GGGTGAAGAAGGGGTTTGAGTTAATGCAGTTTTGAGTTGTGTGGTGAGTGAATGACTTGA
AGGCTGCTGATTTTTCTGGCAGATGTTGAGCTCTTTTATGTTAGATTTGGGAAGGTAAAC
TGGTACAAAAGGGTTTGTGAAAGGTCTGATCAGCCTGAGTTTGACTCAGATGATGGTGAT
AGAGGTAAAAGAGGGCATGGAGTGGGGCAGCGCCTGTGGCTCAAAGGAGTAGGATGCCAG
CCCCATGTGTAAGAGGTGGCGGGTTCAAACCCAGCCCTGGCCCAATACTGCAAAAAAAAA
AAAACCAAAAAAGGAGGGCATGGGGGCTCACGCCTGTAATCTTTAGTACTCTGGGAGGCA
GAGGTGGGTAGATCACCTAACCTTTAGGAGTTTGAGCAAGAGCAAGACCCAGACTCAAAC
TAGCTGGGCATTGTGGGGGCGCCTGTAGTCCCAGCTGCTCAGGAGGCTGAGAAAAGAGGA
TTGCTTGAGCCCAAGAGTTTGAGGTTGCTGTGAGTTATGACGTTACTGTACCCTACCCGG
GGTGACAAAGTGAGACTCTGTCTCAAAAAAAATAAATCATCTACATGCCACCATTAATTA
ACAGTTCCTAGAGAAAATCTGAATCTGCTAGTTTGGTTTATCTTCTTTCAGATTAGGCTA
TTGTATTACTGACTGAACTACAAAATTTTTCTTTCCTTACTTTGACCTCAGATGTCGGTT
TTGAATATGGTAGTGAGACGGGACCCTGGCAACACTGAACCTGTGAAAGCCAAAGAGGAG
CTGATCTTCCACTGTGGGTTCAGGCGCTTCCGAGCCTCACCTTTATTCTCTCAGCATACT
GCAGGTTAGCAGTGTTAGAAGCTTCTGGGTTCTTGTACATCTTACTGTCTTTTGAGAACT
GTGACTTGGGTGGAGGGGTGCACAATACCTCGTTTGAAAATCTTCTGTCTCCAGCCACAT
AGATCAGGGCTAAGGGGTTCGTACCCAGCTTGGGCCTGCCAAACAACAGTGACAACTATA
ACAAAAATTAGCCTGGCATGTAGCTCAGTGGGTAGGGCGCTGGCCACATAGACTGTGGCA
TGCAGGTTCAAATCTGGCCTAGGCCAGCTAAACAACGACAATTGCAACCAAAAAATAGCC
GGGCGTTGTGGCGGGCGCCTGTAGTCCTAGCTACTTGGGAGGCTGAGGCAAGAGAATCGT
TTAAGCCCGAGAATTTAAGGTTGCTGTGAACTGTCACGCCACAGCACTCTACCCAGGGCA
ACGGCTTGAGATTCTGTCTCAAAAAAAGAAAAACAAAACTCTTCAATCTCTCAGAAGTAT
TTTCAATACTCAAGCTTAAAAGCTAATAATTTTTTTTTTTTTTTGAGACAGAGCCTCAAG
CTATCCCCCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGGATGGAATGGGAGTTAGCAGCTTTATAAAAATGGGT
GTGTTAAAGTGTAGAAACCTTTGGTGTCTTGTGTGCAAAGGGCAGTATGGGTAAAGAGAT
AGAGACCTAGATGTGGCCCACATTTGGGTAAAAGCAGGTATGGGTTCTGAGATGTTGGAC
TGGATGAGAATTTGGAGAATAGTGATGAGGAAGAGTTTTGTGACAAAAATGATTGCACTC
CTACATACTACGAATAGAAAGATGCGTTGCCTCTAACTTGGGGACTTCTGAACATCGTCT
TAGCTCACTCAACTAACGATAGGTGAAAGATAATGAAGACCATAGTAATAGTGTTTTGGA
TTTTTTTTTCTTTTTTTGAGATAGAGTCTCAAGCTGTTGCCCTGGGTAGAATGCCATGGC
ATCACACCTCACAGCAACCTCAAATTCTTGGGCTCACATGATTCTCTTGCCTCAGCCTCC
CAAGTAGCTAGGACTACAGGCACCCAGCACACGCCCAGCTATTTTTTTTTCTTTGCAGTT
GTCATTGTTTTTTAGCTGGCCCAGGCTGGTTTGAACCCACCAGCCTCAGTGTATATGGCC
AGCGCTACCCACTGAGCTACGGGCGCCTCCTGTTTTAGATAATTTTTATGCTCACCATGT
TGTCTAAATGAAAAATTTTTCTTTCCCTTAAAATACTTTATTTTCCTATAATTTTAGTAT
TTAAAAAAGGTACGAAAGTTACATTGAAGGTAAAAATAGAAGGTCAGGGTAGTCCTTAAG
ATACAAGGGCAAGTAAACTATGACCTTTGAGCTAAATCTGTCTCTTACTGCTTATTTTTG
TAAGCAGAGTAATTGGAGTTTTTTTTATTTTTTTATTTTTAAAAGTAGCACAGTTGAGTA
GTTGGGACAGGAAATTGTATGGCTGTAAACCTTAATGTATTTACTATTTTTCCATTTACA
AAAAATGTTTGATAATACCTGCTTAAGACTAAGTTGTTGTTTAGTGTAGTTATTCTCTAC
AGTGCATTAATTCCTAAATGTAATAGGGATGGTGGGCAGCATAATCACCTGGAGAACTTT
TTCAAATCCCAAATTTAGTCCTTGCTCCAAGGTTCTGCCTTCTGATAAAAAATATTACTG
ATAAGACTCTCATTTTTATTTGTATTGATACAGGAAAGATTTTTGAGAACTAGTGGGGTA
GAGAAATACAAACTGTTTTAGGTTTAATAGTTGAAATAATAGCCTTTCACAGACCTGGAT
TACCTGTGGTTTTTCAAGATTTTTTGGTTTTTATTTTTTAACTCTTGATATGGCAGCGGA
CAAACATAAATTTCAGAGGTTCCTGACTGCTGATGTGTCCCTGGTGGTGACAGTATATGC
TCCAATCACTTTTCCTCCTGCATCTGTGCTGCTTTTCAAGCAGAAAAGCAATGGTAAGTT
GCTTTGATTGAGTTCACAGGCCTATAGGGCCTTATCAGATTAATACTATTTTCTCTTCCG
TATGTAGATTTGGGAGCCAAATGGGACAGAGAAGGTAATGACAATTTTCAAAATATAGTA
AGTTCTTACTTAACCTCATCAACAAAGTCTTAGAACTGTGACTGTGAGCAAAAAGACATA
TAGCAGTCTTTTTTTTCTCCACTATGTTATCTGGTATAGTGCTGTGTGTCATAGCTCACA
GCAACTCAAACTCTTGGGCTTAAGCAATTCTTTTGCCTTAGCCTCCCAAGAGGCACCCGC
CTCAACACCTAGCTGTTTTTTTTTGTTGTTGTTGTTGTTGTAGCTGGCCTGGGCTGGGTT
TGAACCTGCCACCCTTGGTATATGTGGCTGGTGCCCATAACCACTGTGCTATGGATGCAA
AGCCATACAGCAGGTCCTTGATTAATATAATGTTGGTGAAGAAAAACATTGGTTTTTGTT
ATAAGTATGTTATTTCACTTATCATCACAAGTTTCCAAGAACCTATCGATGAGGTTGAAG
AGTTTACTACTTCATCCTAGGTCTAGGGCAGGGATGACAAACTGCCGCTTGCTTGCAAAC
CTTAGCTAATTGGAGGAAGCTGCTCTGAGTGCTGTGTTTAGGATAGGTTCTAGGGACAGG
CTTAGCAGGAATACTATTTAGTGATCTTTGCCATGGACACAGGAGGGCAGCATAGTATAA
TGTTACTTTAAGGTTTTTCCAATAAAATCTTACATAAGTCTTTAAATAGACTGGAGTGGG
GACGGTGCCTATGGCTTAAGGAGTAGGATAGACTGGAGCAATAAATGAAGGCCCTGGCCT
ATAGCCTCCTGGAACAGACGTCCTGCTTTGCTTTTGCCCCATAGGAATGCACAGCCTCAT
TGCTACAGGCCATCTGTTGTCAGTCAATCCAGATAGAATGGTGATCAAGAGAGTTGTTTT
GAGTGGTCATCCTTTCAAAATTTTTACTAAGATGGCAGTAGTACGTTACATGTTCTTCAA
TAGAGGTAGGTATGAAGAAGGATGATAGGATCTGATTGCCTGTGTGGTATGAAGGTTGGG
TTTACATTTTGTGGGTAAATACTTCATCTTGGTCTTTTATGTGTTATAAGAGGATGTGCT
ATGGTTTAAACCAGTGGAACTGAGAACAAAGTGGGGTCGCAGAGGACACATCAAGGAGCC
TTTAGGTAAGAGAATGTGGGATTTGGGACCTTGTCTAGATTTCTCAGTGTTAACTAAATG
ACTGTTAGATTGGAGGTTATGCTTTAAATTTGTCTTTTAATTTGACCAATTTGCTCTGTT
TTCTTTCTAGGTACTCACGGTCACATGAAGTGTAGCTTTGATGGGAAGCTAAAATCTCAG
GACACAGTACTGATGAACCTCTATAAACGAGTTTTCCCCAAATGGACTTATGATCCATAT
GTACCAGAACCACTACCATGGGTAAAAAGTGATATTTCTTCAACAGTGCCTGAAGTGGGC
ATGGAGTGATGGATTTAAATAAATTCTGTTTTGCTCGTGCCAGTTAACATTCTAGGGATG
ACAGTCTACAGGTTGTGATTGGGCAAAGTTTGTTTTCTATGTTAGCCTATCAGTCTGTTG
TCCCATTTGCAAAAGACTTTGCTTGGCCTTGATAATGTGTCTCAGTTAAGTATGAAAGTT
TTTCTACTACTACGTAATCCAAAAAACTATTAAATCTTTACTGAAATATCCACTCTCTAT
TAAGCATTCAAAAACATTAAGAGGGAAGATGGAAAGTTGTTAATGACCAGGAAACAAAAT
GTTCAAGCATGTATAGACACTGATCCCATCTTTTCCTTTTGCATAAATCAAACAGAAACA
GATTGGAAAGGAGCTGGAATTTCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1275..1378, 1660..1879, 1982..2116, 2745..3049, 3053..3169, 5281..5440, 6589..6740, 7018..7061, 7063..7212, 21558..21720, 22120..22230, 23331..23463, 25616..25732, 26624..26764, 26870..26944, 27070..27248
1001..1097, 1275..1378, 1660..1879, 1982..2116, 2745..3049, 3053..3169, 5281..5440, 6589..6740, 7018..7061, 7063..7212, 21558..21720, 22120..22230, 23331..23463, 25616..25732, 26624..26764, 26870..26944, 27070..27245
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved