Otolemur_garnettii Locus ENSOGAG00000010098
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000010098
Otolemur_garnettii
ENSOGAG00000010098
GeneScaffold_3490
SNORA64
3072..3202
4441
TGGGGAGGTTAAGTCTAGCACACGGATAGAGAACAGTATTTTCAACCTGGGTCTGCCAT
TTTGGAGGTGTGGGGCGTTAGACGCCAGCTGCCAACCTCCAAAGTGTGTCCAAAGCTGCG
TTGGGCTAGCCTGGGAAGAGGAGGAATCCCAGTAAGGTCCCCAGCCCGAAACAAATGTTT
TCCAGGCTGACATGTGGGGCATAAGAACATCCACACGCGGATATAATTTGACACACAGCT
TCTTTATTCGATACAAAGAACAACCAAATCCTTTTTCCTTTTGGTCCCGGCGGCGTCAGG
CGGGAAACAACCAGGGTCCTGTTGATAGAAAATAGAGTTAGGGGTCGGAAGCCAGACCAT
GCGGACGGCGGCCCCAGAGTCCCGGGCCACTTCACCTGTCGGGGCCTGGGTTTCACCCCC
GCACACGAGGCAGTGGGCGGTGAGCTGAGGCCCCTGCTGGCTCTAGGCGCCGCTTCTCAC
TCCCGGCTACAGCCAAAGCCGGGGGTGATTTTCAACCAACGCCCCGACCAACCAGCAGCA
TGCACATAGCAAGCGGCCATAGCGGCCAAACCTACCTCTACGTACAGACGGGTGTCAAGG
CTGCTCGGGAGACTCACCGCGCTTTGATGCCGCGTTTATAACTACCCTTCCGGTCATGCA
GATTTCCGGGCCAAGGCTGAGCAGTTCACGCAGACGCACACAGAACCAATCGCAGACTGT
CTTGTGGGCGTTTGGTTCGCTCGTTTTGGGGGCGGGGCAGCCGAGATCTCGCGGCTCTTG
GTATGGTATATAAGCTTCCTCTCGCGCTTGATCGCTCTTCTTTTCTGACAAAAACACGTG
AGTCTGTACGATTATGGTGGCGGCGGGCGGCCTGGGTGGCGGCATCCGCAAACATCCAGC
TAAATTCGGGCTCGTTCGCCCCCGCTCTTGAGCAGAGCCCCCATCTGGGTCCGCAACGGA
CCCAGATACCCTGTCTCACTGTATTTTGTTTTATTCAGCAAATGGCGGATGACGCCGGTG
CAGCGGGAGGGCCTGGAGGCCCTGGGGGCCCTGGAATGGGAGGCCGTGGTGGTTTCCGTG
GAGGCTTCGGCAGCGGCATTCGAGGCCGGGGTCGCGGCCGTGGTCGTGGTCGGGGCCGAG
GCCGTGGAGCTCGCGGAGGCAAGGCCGAGGACAAAGAGGTTCGACTCGCGCGGTAGAACC
GTAGGGGCCGCCGGGGAGGCAGTTGGTTTTTGTTTTTGTGTTTTTGAGACAGAGTCTCAT
TTTCTTGCCCTCGGTAGAGTGCCGTGATGTTATAGCTCACAGTACTCTCCAGTTCTTGGG
TTTAGGTGTTTATTTTGTTTCAGCTTGTCTCAGCTTTCTGAGTAGTTGGGACTTCAGGCG
CCTACCACAATGCCCGGCTAGTTTTAGAGACGGGGTCCCGCTGTAGCTCAGGCTGGTCTC
GAACCTGTGAGCTCAGGCAATCCATCCGTCTCGGCCTCCCAGAGTGCTTGGATTACAGCA
GGGAGGCAGTTGTTAACTCGCACTTTCTATCCAAGTGGATGCCCGTCACCAAGCTGGGCC
GCCTGGTCAAGGACATGAAGATCAAATCCCTGGAGGAGATCTATCTTTTCTCTCTGCCCA
TTAAGGTACGATTGTTGGGGTGTTGCGAAAGTGTGAGTGACACTGGTGAGCCTTGGGCTG
GGGTCTAAGGGTTGAGATCTGCTATTGTCCCACTTCGAGGTCCCTTAGGTCTCCCATTTT
ACAGATGGAGGTTGTGTTATGGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGG
TCATTCAGTAAGTACTGATACATTAGAAGACTCCCAGCACTCACAGTCTCTTGCAGGCGT
TGTTGCATTGGGGACTACATGACACGTCGGCCTGGGTGTTAAGTGTTCCAAGGAAGTAGC
CACTGCCATCCGAGGGGCCATCATCCTACCAAGCTCTCTATGTCCCAGTGCGGAGAGGTT
ACTGGGGGAATAAGATCGGCAAGCCTCACACTGTTCCTTGCAAGGTAGGCCTGGTGGTGG
TGGTGAGAGTGTTGGGTCTGATACAGACTCTTGGCCCTGGTCTGACTCTCACCTTTTTCA
GGTGACAGGCCGTTGTGGCTCTGTGCTGGTACGTCTCATCCCTGCTCCTAGAGGAACTGG
CATTGTCTCAGCACCTGTGCCTAAGAAACTGCTAATGATGGCTGAGATCGATGACTGCTA
CACTTCAGCCAGGGGCTGCACTGCCACCCTGGGCAACTTTGGTAGGTGACTGACAAACAG
GATCAGCTATGATCTCTCCCAGCTCCGCTTGATCACACAGATACAGGGTGTGCTTGGCGT
TTTCAGGGAGAGAAAGGAAGGCTCTCCTAATGCACGACAGAATTGCCCACAGTGGCCTCT
CTGTTCCTGGGAGTGCAACATCTTCAGGTCCTGGGGTTGAGGGTTTGTCTCAAGTCATAC
CACCAATCCTCCTATTTTCTGTTTTCTAGCCAAGGCCACTTTTGATGCCATTTCCAAGAC
CTATAGCTATCTCACTCCTGATCTCTGGAAAGAGACAGTGTTCACCAAGTCTCCTTACCA
AGAATTCACTGACCATCTTGTCAAGACCCACACCAGAGTCTCTGTGCAAAGGACCCAGGC
TCCAGCTGTGGCTACAACATAGGGTTTTTATACAAGAATAAAGTGAATTAAGTCTGTTAA
TGATTGTCTTTTTCTTTCTTTCTTTTTTTGACTGGGGCTGGGTTTGAATCCATCACCTCT
GGTTTAAGGGACCAGTGCCCTACTCCTTTGAGCCACAGGAACTGCCCAGTTGTCTTAAAA
GTGGGATCTAAGTGTCTCGGCACCTGTAGCTCAAGCAGTTAGCCAGCCACATAAACCTGA
ACTGGTGAGTTCAAATCCAGCCCAGGCCTGCCAACAGTGACAACTACAACTAAGAAATAG
CTGGGTGTTATGGTGGTTCCCTGTATGTAGTCCCAGCTACTTGGGAGGCTAAGGCAAGAG
AAATGCTTAAGCCCAGGAGTTGGAGGTTGCTATGAGCTGTGATGCCACTGCACTCTACCT
AAGGTGACAGCTTGAGGCTTTGTCTCCAAAAAAAAAAAAAAGACTTTAAGATGAGGAATT
AGATTGGGGGGGGGGGGCGCTGGAGATTACACAAAAGGTACACAAGTAGATTGTATCACT
TTATTAATAGTTATATAAGGTAGGAATGCACAGCTGTCTCAGGCAGCAGCAGCCTCTTTC
GCAGCCTTTCTCTCTGCCAGCATCCTTTGCTTCTGTTTTGCCAGGCACTTTCTGGCAGAG
TAGTGGGCTCCCAGGTCATGATCTGTAAGAGATGGAAACAAACCAAAGTGTCTACATGCA
GAGAAAAAGTTGGTGGCTAAGACCAAATAGACATGGTGCACCTTCCTCCACAACAGACGA
AGCTGTGTGGAGCCTGGACAGACTACAGGGGAGAGAGATGGCAAGAAAGCAAGACTCTGT
GCCAGGGTGGGGCTTACAGCGGTCCTGGTAGGCCTTGGCCACTTTGGTGAACTGCTCCAG
TTCATTGTTACAGTTCTGCTTGTAGTTCTGTCCTTCTCTCTGCTGACAGGCCTTTAACCT
CTCTTGAATAATATTGACAATTTCCTGATCGACTTTGCTGGGAGCAAAAAGGGAACAAGA
GG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1177, 1535..1624, 2117..2224, 2636..2638, 2641..2643, 2646..2657, 2662..2727, 2730..2738, 2741..2803, 2881..3040, 3269..3441
1001..1177, 1535..1624, 2117..2224, 2636..2638, 2641..2643, 2646..2657, 2662..2727, 2730..2738, 2741..2803, 2881..3040, 3269..3438
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved