Otolemur_garnettii Locus BAT2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii BAT2
Otolemur_garnettii
BAT2
GeneScaffold_437
SNORA38
1555..1683
17263
ATGCTTTTCTGCTTGCAGCAGAACTCACATTTTAATCAAAATTAACATTAAGGCTCTAA
GAGTCAAGCAACAGACATTAACAGAAAAACGTGTCACACCAATGAAAAGTACTATATTTT
GCTGTGTATAATGCACATTTTTTGGCCCAAACTTTTGAGGGATAAAAGAAGAATCTCATT
ATACATGTGTAGTATGGCTCAGGCTCAACTGAGAGCCCGCCAGTACTCCATCTGGAGGTG
ATATTTTTTCCAGGAGCCAAGATGGGGAGCAAGTGTAGGAAAAGATGGAGTATTCTAAGT
ACTTGGGGTTTTACCGTTTGTTAGTCTGTATAGTCCCTGTTGTTCCATGAGGATTTCTCT
GGCACCAGACCTCTGACTGAGCAAGCTCATAAAATCCTTAAACTCCAGCATACCTTCCTC
CAAATCTCCCAGATGGGACATGAGACTGCTAGGAATGGAACCTGGGGTACAGGGCCCTGG
GGCATGATGGGAAAGCTGGTATCAAATAAAGAGAGGAGTTTCAAACCTCTGTTCCTTGGA
CAATGGAATTGTATGCCTTTTTATGGTTTTCTTTGAGTCTTGACTTGCCTCATTTAAGTC
TCTGAAGTGATTTGGCGATGTGGGATAGAGGCTGCTATGCTTTGTAGAATGGCACAAAGG
ACAGAGCATTTACACTAGGAAAATACTGGATTTTTGTTTGTGTTTCCTAGGTAGAGGTGT
TTGGAGGAAAGGAGAAAACATGTATTTGGGCTACATGGGAGCTGAGTAGATTGTGGCTAC
TTAAAGAGACTAGGAAGTTTACATATGCTAGAAGAGAAGAAAAGATACCAGAAGTCCACA
TAATCTGAGTACCCATTGAGAATAAAAGAAAACTTTCAGATTTCTGTTACAGTCTATAAA
GGGCACAGAGACTGAGATACTCACTTTTTGGCCCACAGGCTCCGGCACGTTTTGGGGGAG
GTGCCTGCAGGACCCAACATACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCACTCAACCTGTTTGATACATATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGTCCTGCAAAGATGCCTCTAA
TCCCTGAAAGCTAGACCTGAATGGGACATGTATTTTACAGTTCTTTGAGGGGAAATGGCT
GTAGTAGAGATACCAAGACCAGGGAAGAGTTGAGTGTGTGGCTCAGTTCTTTAATCCCAG
TGAGTCAGGAGGCTGAGGTGGGAGGGTCCGTGAGACAGGCCTGGGCAACATAGCAAGACC
CTGTCTCAAAAAATAAGAAAAAACTAGGCATGGAGGCACATGCCTATCTAGGCCTGGCCA
CTTGGGAGGCTGAAGCAGGACATCCCTTGAGTTTAAGGTTGGAGTGAGGTGACGCTATTA
CACTCAAGCCTGGGTGATAGAGTGATACCCTATCTGGGGGCGGGGAGACTGCAGGGACAC
TAGAGGCTTTCCAACTTTACTTTGAATCCTTTTGAGGGTGGGCAAACATCAGTTATTCTC
CTACAAAGGCGTGTCTGTGGTTCCCCATCTTTGGACATGTAAGAATTTGAGGCAAAGAAA
TGTGGATTTGGAGAAGTCTGGGGCCAGCTTACTCCCCAGGCTCAAAATCAAGCATCCCAC
ATAGAAGCATTACATGTAATACATACATCTCAGCCTTCCTGATAGGGATTTCATGGATTA
ATCAAAAGCAGGGGAAGGGCCCCCTTCTAAGAAGTTTGGATGAAATAGGTAATAAAACAT
TGAGGATATATAAATGGGCCCAGGGTGGGTGGCTGTCAGTTCTTCCATGTGAGGTATTTT
TGACTCTCTCCCACCTTTTCTCCAGTTGCCCCTCGCCATGGCCTGCAGAGTCTCGGGAAA
GTTGCCATTGCCCGGCGTATGCCACCCCCAGCCAATCTTCCAAGCCTGAAAGCCGAGAAC
AAAGGCAATGACCCCAATGTCTCATTAGTGCCGAAAGACGGAACAGGATGGGCAAGCAAA
CAGGAACAGTCCGACCCCAAGAGGTAGGTAGAGGCTTGGGGGCTAGAGTGATGAATATTT
TAACTTTAAACTTTGGGGAAAATTGTGCTTGGTCTAACCCAACCACATAAAAGCCAGAGA
CAAAGGGGAGGTGCTTTTCCTATCTATCTCAGGTCTCCTGTTAAATAATAAGGAATGGTA
TCTTTAGCTTTCTGTCAGATGGTGAGAAAGCTTCAGGAAATAACCTATACAAGATGACAA
AATTAGTTTATCTTAATGTTTATAAATGATAACAATGGGCCTGATTTTTGTTCCTATTCT
CCACCAGTTGGAGAAGTAGGGAAGGCATCTCAGACCTCAATAACCTTCCCATTCTATCAT
CCCTTCAGTTCCGATGCCTCAACCGCTCAGCTGCCGGAATCGCAGCCACTGCCGGCTTCA
CAGACGCCTGCCTCCAACCAGCCGAAACGACCCCCAACAGCCCCCGAGGTACCTGTGGAG
AACTGGGGCAGGGGGCTAGCTCATAGCCGTTCCACACACATTACCACTTACCGTCTTTCT
GCTTCCCCAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCACAAGCCAGCGT
CACCCATGGAGCACATGGAGATGGTGAGTGCGCAGTTCTTCAGGGAGCTACCTGTGTTTG
GCCACTATGGGAGGCAGGACCCCTATATGGTACCTTCAGCACAGTGTCTCTTGATCCCTC
TTTGGCTAAACCTTGGATCAGGACCACTGATATTCACTTTTATGGTGCACATGAGCAAGT
TTAAATATCAGTTTTGTGTAAAGGAGTGGAGGGGTCCCAGAACTGACCTTAGTTCTTTGG
GAATGAGTACCTATTCCATAGGAAGTTAAATTTGAAGGCAGGAACTCAGCAATCTGGTAT
CTGTCAGAGCCTTCTATTTTTACTGTGTGTCTTAAGTAAATGTACATTTGTTTCTTGTTC
TGCACCCCTATCCCAATAGGTGGAAGGGCATCAAGCCTACTGTCACGATTCTCTCGAGAG
GAATTTCCGACCCTGCAGGCGGCTGGCGACCAGGACAAGGCTGCCAAGGAAAGGGAGTCT
GCCGAGCCGTCGTCTGGGCCCGGACCAAGCCTCCGCCCCCAAAGTGAGTGCTGCCTTTTG
GCCAGAATATCACCTGTTCCATTTCAAAATTAATTGCTGTTTTATTCCTTTTCTTCTCCA
TCATTTTTAGTTAGCTATGTTCACTTGCCCCTGAATTATTGGTGTGTGTTTCTCTCTCTG
TCTCTGTCTTTTCCAAAATACAGATTCTACAACTTGGAGGGATGGAGGTGGGCGTGGCCC
TGATGAACTGGAGGGCCCAGACTCCAAACTTCATCATGGTCATGATCCCCGGGCAGGGCT
GCAGCCGTCAGGCCCACCCCAGTTCCCTCCCTACCGCGGAATGATGCCGCCTTTCGTGAG
TTCAGATTTATTTGGGGGTGATTTTGCTAGAAACTGGAGAATGAGGAATCAGGACTTAGT
TTTTGGAAGGGCCAGCTAGAAAGTCAGGGACATATGAGATGAAGGAGGGGATGATGATAG
TTTAAGGAGCTGGAAGGCAGTTTGACTGTCTTGCTGAGCAGCTATTGTTGGGCCCTTTTG
CAGATGTATCCCCCATATCTCCCGTTTCCTCCGCCCTATGGACCCCAGGGGCCTTACCGA
TATCCTACTCCTGATGGGCCCAGGTGAGCAATCCAGATTTATGGTTGGGGGTAGGGGAAA
CCTGTTGGGGAAGGAGATGGTTTTCTAACCAGGAGGCTCAGTCTTATATGTGGTTATACA
GTAACGCCATTTTACATCTTCTTTCCTATTTTCTTTTCCATATATAGCCGTTTCCCCCGT
GTGGCAGGCCCCCGTGGCTCTGGGCCACCAATGCGCCTTGTAGAGCCTGTGGGTCGTCCT
TCTATTCTTAAAGAGGATAATCTCAAAGAGTTTGATCAGTTGGACCAGGAGAATGATGAT
GGTTGGGCAGGTAAGTGGATATTAAGGGTCAAATATTTGGATCTGAAAAGGCAAAGTGAC
GAACATGGGGGGAGGTCGTGTGGAAGGAAAAAAGACATTGAAGGGTAAGGGATTAATAGA
GAAAAACCAAGTCCTGGCAAAGTTCCGAGAGAAGTAGGAATGACAGGACTCATAATTGGT
GGATCTTGATTACAGAGGGAGAGGGTTGGAACTAGTAGTACATCCCACCACATAGTTCCA
GATCACTTTTTGGGTCCCAGGAAGATATCTGAGATTGAAGAGCAGATGCTGAGTATACAC
TATTTTATCTGTCCCTAGGACCATGAAGTAGTTGACTACACTGGAAAGCTCAAATTCAGT
GATGAGAGACGGCGAGATTCTGATGAGGAGGGAACTGAGACCAGTAAGTAGAGTCACCAG
GGAGAAAAGGGGGCTTGGTTTGTTTCACAGTAATATACTCTTAGAAGAGCTGGGTGTAGC
TGATTTTAATTTCACTGTTGATCTGCTCACAGCAAGGATTCCCAATTAGCTGCTGGTGAG
GAACGTCCCCCTGAAGCAGATGGCAAAAAGGGCAACTCCCCTGGCAGTGAACCACCTCCT
CCCAAGACAGCCTGGGCAGAGACCTCTCGGCCTCCAGAGACAGAGCCGGGGCCTCCTGCC
CCAAAGCCTCCCCCACCCCCACCTCACCGGGGCCCCACTGGGAACTGGGGTCCCCCTGGG
GACTACCCAGTGAGTATCTACAATGAGGGATTGAGAGGGTCAGTTGTGGGAGATTTGAAA
CAGTCTTATAGAGGAAGCTGGAGGGAGGGCTGAACATGAGCTGTGTGAAGTGCAGAACTG
TAGAGCAGCCCTGGAAAGCTTGAGAACATCCTTAATGTTAGGGGAGTTGGCTCGGCGCCT
GTGGCTCAAGCGGCTAAGGCGCCAGCCACATACACCTAAGGTGGCGGGTTCGAATCCCCA
GCCCGGGCCCACCAGACAACAATGATGGCTGCAACCAAAAAATGGCCAGGCGTTGTGGCG
GGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCTTGAGCCCAGGAG
TCGGAGGTTGCTGTAAGCGTGATGCCATGGCACTCTACCCAGGGGGATAGCTTGAGGCTC
AGTCTCAAAAAAAAAAAAACAAAGTGTTAGGGGAGTCAAGATAAGGAATAGGAGAAATTG
GGATGCTAGTAGAGGAAGAACAAGGAGGGGCTGGGTGTTTGGGTCTCTGAGGGTGAGAGG
GACCAGAGAAAATAAAAGACTAGGGTGGGGACGGCACCTTGTGGCTCAGTGGTAAGGGTG
CAAGCCCCATATTACCCAGGTGGAAGTTTCAAACTCAGCCCCAGCCCAATTGCAACAAAA
AAATAGCTGGGCGTTATGGCAGGTGCCTGTAGTCCCAACTACTCAGGAGGCTAAGGCAAG
AGAATCACCTAAGCCCAGGAGGTGGAGGTTGCTTTGAGCTTTGTGATACCAAGGCACTCT
ACCGAGGCAATAAAGTGAAACTTTGTCTCTTAAAAAAAAAAAAAAAAGACTAGAGTGTCT
GCGGTATTGAGCATCTGTCGTCCCAGCTACTTAGGAGGCTGAAGTGGCAGTATTAAGCCC
TAGAAATTCTAGACCAGAAAACATAGAGCCTGTCTCAAAAAACAACAAAAGAACCAAGGT
GATGAGTCCCTACCCAGAGAGGTCTTCAACCCCCAAGCCCTGGTCCTTGTATTCTGTAGC
TAGAAACAGTTGATTGGTCCATGAAAGTGATGGTAGAAAGCATAGTGACTGACATTCCTG
GCCTTGCCGGGTCTGCCCATTGACAGGATCGTGGGGGCCCTCCCTGCAAGCCCCCAGCAC
CTGAAGATGAGGATGAGGCATGGCGGCAACGACGAAAGCAGTCTTCATCTGAAATCTCTC
TGGCTGTGGAGCGTGCCCGTCGAAGGCGAGAGGAAGAAGAGCGGCGTATGCAGGAAGAGC
GCCGGGCAGCCTGTGCCGAGAAGCTCAAACGGCTGGATGAAAAGTTTGGGGCACCTGACA
AGCGGCTCAAAGCAGAGCCTGCTGCCCCACCTCCTGTCCCTCCTGCCCCAGCTCCACCAC
CTGCAGTCCCCAAAGAACTCCTTGCACCTGCAGCTCCACCACCGGCATCAGCCCCAACAC
CAGAGAAAGAATCTGAAGAACCAGCACAGGCCCTTCCTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATCTCTGCTTGCTTAAAGGTA
CAGGGTGGTAAGGATGGAAGTAAATGAAGACAGTTGTTTTGATTTATTGGACTACACATG
GTAGGGGAGGAGAGTCCTATCATTTGTAGGGGTATCTGAAGAAAGGTTTGTTATCTGAAT
TTCTGAATAAATTGTGATCTAAAACAATTTTTTTTTTTTTTTTTTTTTTTTTTGGAGACA
GAGCCTCAAGCTGTCTCCCTGGGTAGAGTGCTGTGGCATTACAGCTCACAGCAACCTCCA
ACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCAAGTAGCTGGGACCACAGGCGC
CTGCCACAACGCCTGGCTATTTTTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGG
CTGGGGATTCGAACCCGCCACCTTAGGTGTACGTGGCTAGCACCGAGCTAAAACAATTTT
TTGTAGGGCAGCGCTGAAGAAAGTGTCATTTTGATAGTTTCATAGATTAATGCCACCACT
ATAGACTCTTAAGGAGACATAAAGCATTTTTATGGGTTGTTAAACAGAAAGGGCTTTGGT
AGGTCAGGTGTCAAGTAGAGTGTCAAGTAGGTATCAAGTGAGCTAGAGGAGGAAAGACTG
ATATTCCTGGGTTCATGGAATGAATGTTGATGGACCAGGTCACTGTGACTGTTGTCTTTT
CTTCAATACAGTGGAATCACAGCTGCCCTCAAAAGAGGGTCCTGAACCATCAGAAGAGGT
TCCTCCTCCTACCACGCCCCCAGCCCCAAAGGTGGAACCCCCCAAGGGTGATGGAGTTGG
TCCTACTCGGCAGCCTACTAGCCAAGGCTTGGGCTACCCTAAATACCAGAAATCATTACC
TCCTCGTTTCCAGCGGCAGCAGCAGGTGAAATCAAGTTATTACCCCTCTAAGGGCTGCTT
CCTTTCCTGGCTTTAATATTTATCCATAAGTTACCTTCTGGGTCCCTCTGCCTCTTTGTC
CAGTTTTGTTTCCATTATGTCACCTGTTTCCATCTAGCTGGGGTTTTGTTACATTTGAGC
ATTAATGATTTTTCTTCGCTGATTCCTTTGTGTGTGCTTTGATGCCTGTCTCATCCTCTT
TCTTCTTCCCTAGGAGCAGCTTCTGAAACAGCAGCAGCAGCAGCAGTGGCAACAGCATCA
ACAGGGCTCTGCCCCTCCTGCTCCAGTGCCCCCATCACCACCACAGCCTGTGACCCTGGG
GGCTGTGCCAGCTCCACAGGCTCCACCACCCCCTCCTAAGGCTCTGTACCCAGGTGCTTT
GGGCCGGCCCCCGCCCATGCCCCCAATGAACTTTGATCCCCGCTGGATGATGATTCCTCC
TTATGTGGACCCCCGGCTCCTCCAGGGCCGGCCCCCTCTTGACTTCTACCCTCCTGGCGT
GCATCCCTCTGGTAAGGCCATGGGACAGGTGGGGAGCCCCTCAGTCGTGTGAGTTGTTGG
ATATCAGAATCTTATTGTGACTCTTGTGTGACAGGTTTTACCAGTGAGAAAGGGAGTGTA
TATAGAGTTAGGTCTGTTGCAGGAATGGGCTTAGAGAAGGAATATACAGTTGACTTTCAT
TGGCCAGAGTTTATTTGGGGCGGTTTGATCCTTTCATAGGGAAACTAAGTGGTTAGCCCC
GTTTCACAAGAGTGGGCAAGGCTCAGACTGGGAGCAAAAGATGGAGGAACTGACTTGACA
GGGAATACTAGACTAGGGAGGCACTTTTGTCCTGTAGGGCCTGTGAAATAAGAAGAGTTA
TTCTTTTATTTCTTCAGGCCTAGTTCCCCGGGAGCGCTCAGACAGTTGAGGCTCAACTCA
GAGCCATTTGACCGTCATGCACCCCCCTTTTACGGGAACGGGGCACCCACCAGTAGATCC
AAAGTTGGCCTGGGTAGGAGATGTCTTCGGTACAACATCCACTGACCCTAGGCCACTTAC
CTCACCACTGCGCCAGGCTGCAGATGAGGATGACAAGGGCCTGAGGTGAGTCTTGGTTAT
GAGAAATGGGTGAGTTCCTAGTGATGATAGGATCTAGGCCTAAAAGAAAGGGATTTGGAT
CAGTGGTAAGATAATAGTGATGAATAGGAAAGATCATAAAACTAAGTGTTCTCTTCTCAC
CTAGTTCTGGTATTCCTCATCCTGAGATAATTCTCCTTCTTTTCTGTCTCTCTTCAGGAG
TGAGACTCCTCCAGTACCTCCCCCACCACCCTATCTGGCCAGTTATCCAGGCTTTCCTGA
GAATGGAGCCCCTGGGCCCCCAATCTCTCGCTTCCCTCTGGAGGAGCCAGCTCCCCCAGG
GCCCCGTCCACTCCCCTGGCCTCCAAGCAATGATGAGGCAACCAAGACGCAAGCACCACC
CAAGAAAGACCCCCCCAAGGAGGACACTGCACAGTTGACAGGGCCAGAAGCAAGCCGAAA
GCCGGCCCGTGGAGTCGGAAGTGGAGGCCAAGGCCCCCCACCACCACGCAGAGAAAGTCG
CACAGAGACTCGCTGGGGCCCTCGCCCAGGGAGCAGTCGTCGGGGAATCCCTCCAGAGGA
GCCAGGCTCCTCCCGCCGCTGACTATAAAGAAACTACACACTGCAAAGTGGAAGAGCTGC
TCCCAGCCCTCGACAGGCGATGAAACCCCCAGATCCCATCCAGACCCACTAAAGACAGCA
AAGGGAAACTAGGGGTCCCAAAGAGACCCCACCCAGTGGGAATCTTTCCCTGCCCCAAGG
CTTCGGAGGGACTATTCCTATGAACGAGTGGGTCCTACCTCTGCCGGGGTCGGGGCCGCG
GTGAATATTTTGCCAGAGGGAGGGGTTTTCGGGGAACCTATGGGGGAAGGGGACGGGGAG
CACGAAGCAGAGAGTTCCGCAGTTACCGAGAGTTCCGAGGAGATGATGGGCGTGGAGGTG
GGGCAGGAGGACCAAACCACCCACCTGCTCCCCGTGGCCGCACTGCCAGTGAGACACGAA
GTGAGGGTTCAGAATATGAGGAAATACCCAAGCGGCGCCGACAGCGTGGCTCAGAAACAG
GCAGTGAGACCCACGAGAGTGATCTGGCTCCCTCGGACAAGGAAGCCCCCCCACCCAAAG
AGGGAGTACTCACCCAAGCTCCTCTTACTCACCCCCCACCAGGAGCCCCACCTTCACCAG
CCCCAGCACGCTTCTCCACTGCCCGGGGTGGGCGAGTCTTCACTCCTAGAGGGGTGCCGT
CACGCAGGGGCCGAGGGGGAGGGCGGCCCCCTCCTCCTGTTTGCCCAGGCTGGAGCTCTC
CAGCCAAGCCCTTGGCTCCCAAGAAACCACCTGCAGGCCCTTTGCCATCAAGTAAGGAAC
CTCTGAAAGAGAAGTTGATTCCAGGGCCTTTGTCCACTATGACTCGGGGAACAAGCAGTG
GAGGTAATAATGTGGGCATGGGTGTAGAAGATGGGGAGCGACCACGAAGGAGGCGACATG
GGCGAGCTCAACAGCAGGACAAGCCACCTCGTTTCCGGAGGCTGAAACAGGAAAGGGAGA
ATGCAGCCAGAGGGGCCGAGGGCAAGCCTTCCTCCCTGGCCCTTCCAGCCTCCACTCCTG
GACCTGAGGAGACCCTCACAACAGCCACAGTGCCCCCACCACCTCGCAGGGCAGCTGCCA
AATCTCCTGATTTGTCAAACCAGAACTCAGACCAAGCCAATGAGGAATGGGAGACTGCAT
CAGAGAGTAGTGACTTTGCCAGTGAGCGCAGGGGGGACAAAGAGGCTCCCCCTCCAGCAT
TGCTGACCCCCAAAGCTGTGGGAACTCCTGGGGGCAGTGGAGGTGGCCCTGCACCAGGCA
TTTCAACCATGTCCCGTGGCGATCTGAGCCAGAGAGCCAAGGATTTGAGTAAGCGAAGTT
TCTCCAGTCAGCGGCCAGGCATGGAACGACAGAACCGGCGCCCGGGTCCTGGGGGCAAAG
CTGGCAGCAGTGGTGGCAGCAGTGGAGGTGGCAGCGGGGGTTCTGGGGGAAGGACCGGAC
CAGGACGAGGGGATAAGAGGACCTGGCCCTCTCCCAAGAACCGAAGGTGGGTAGGGATAG
ACCGTCAGGTGTATGCTTAGGGTTTAAATTGGGGAAGGTCTGGGCACAGTGGCTTCCACC
TATGATCCTAGCACTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GCTTGAGCTCAGTCAGGACTTAGAAACCAGCCTGACAAGGCAAGACCCTGTCTCGAAAAA
TAGCTGGGTGCTGTGGTGGTGCTAGCTCCCGTGTAGTCAACTACTCCAGAGCTGAGGCAG
GAGAAACACTTGAGCCCAAGAGTTTGAGGTGGTTGTGAGCTATGGTGCTATGGCACTCTA
CCAAGGGCGATGCAGTGGGACTCTATCAAAAATAAACTGTTGGGGAAAGGGCAAAGGCCC
TTGGGGTGAGGTGAGTTTGGGTGCTGTGGTGTTTGTGACCAAGGGGCCATGGACTTTCTG
AAAGGCACCGTGGTTTGCACACCTAGGTAATAGAGAGCAATTGATAGGATGGTAGAGTCA
GGAATACTTGTATATTTATTCCTTGTTCTTTGCTTTCCACTCTACAGACTATACGTGTAG
AAAACTCTTAGAAGAGCTGAAAAACACCAGGGTAGGGAAGGGGATAGGTTGTAAGGGGGA
GAAGTTAGAAAACAGATAATTGACTTGGGAGGATAAAGTAATTAATGATATAGCAAATAC
TAGAGCTGATGTTCTGTTTTCTTTAGCCGTCCTCCAGAGGAGCGTCCCCCGGGGCTTCCC
CTGCCACCTCCACCTCCCAGTAGTTCTGCTGTCTTCCGATTGGACCAAGTTATCCACAGT
AACCCTGCTGGCATCCAACAAGCTCTGGCCCAGCTTAGCAGCCGCCAAGGGAATGTAACT
ACACCGGGGGGGCACCCAAGGCACAAGCCTGGGCCTCCCCAAGCTCCTCAGGGCCCTCCT
GCTAGAGCCCCATCCCAGTATGAGCCCCAGAGGACCAGCAGCAGTAGCATCACTTCTGGT
AAGCTGGAGTGGTTATGCATGGGAATATCTATGTTCCCAAAGAAGGGCAGATGTTGGAGG
GAGAGCGTCTGGCTTGGGGGCCCTGTTGCTGATGTCTGTAGACAGCAAGGGTAGAAGGAT
TGGGTGGTAGAATAGGGAGGGAAAGCTAGGGTTGGTGGTAGAGCAAGGCAGTTGCTGATG
GTTTTCTCTCTTCTTTAGACCCTCGCTTTGAGGAGCCAGGGCCAATGGTGAGAGGGGTGG
GTGGGAGTCCCCGGGATCCCACCGGGGTTAATCCCTTCCCCCCCAAACGTCGGGAGCGGC
CTCCTAGAAAACCAGAGTTGCTGCAGGAGGTGAGGATGGGGTTTGAGAGTGTGCTTCACT
GCACTTTTACTCCTAAAAGTTCTTGGGGTTTTTTCTTCACTCTTTTCCCCATTTATGCCG
TGTTTTCACTCAAAATCCTCACTATATGATTTGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTCAGTCCCTACTTTAATTCATGTTTTGCCTCTGGCCTTTCTCATCT
TTAGGAATCTTTGCCACCGCCTCATAGCTCTGGATTCTTGGACTCTAAGCCTGAGGACCC
AGGCCCTCAGGGAGAATCTAGAGATGCAGGAACAGAGGCCCTGACCCCTCACATCTGGAA
TCATTTACATACTGGTGAGTAAAGCTAAGTGAAAGCAAAGGACTACAGTAGAAGGATGAG
ATGGACTTGAGAACTGTCCTCTCCTCTCACTTTCTCTCTCTGGTCGGTGCTTCCTTCTCC
AGCAGCTAGCCAAAAGAGTTACCGCCCAAGCTCCATGGAGCCCTGGATGGAGCCCCTGAA
TCCTTTTGAGGATGTGGCTAGCACAGAGGTAAGTGAGGATGGGAGCATCTGAGCTGAGAT
ACTGTTAAGCACTTGACCATACTTCCCCACCTCCTCTGGATCAAGTCTGGGGTATCCTCT
CACTTGGTTGCCTCCTTTAGTTTTTGTATATGTGTGCACCAGTCAGGTATTGGGATGCTT
TCTACCCTGACTTAACTAGCTCCTTCTCCACTCCTCTCAGATGAGTCAGTCTGACAGTGG
GGTGGACCTGAGTGGGGATTCTCAGGTGTCATCAGGTCCCTGCAGCCAGCGAAGTTCCCC
TGATGGAGGACTCAAGGGGGCAGCAGAGGGACCCCCCAAGCGGCCTGGAGGCCCCTCCCC
CCTGAATGCTGTTCCTTGTGAGGGTCCACCTGGCTCTGAACCCTCTGAACCTCCTAGGAG
ACGGCCACCTGCCCCCCACGATGGGGACAGAAAGGTAAAAAAACAAGAAATGATTAGAGT
GATTGTTTCTAGAAATCTGACTTTGGCCCTGCCTGTGTTTGGGGGATTGCCTAATTTGGG
CTTCCCTTTCCCAACCCAGGAGCTGCCCCGGGAGCAGCCTCTTCCCCCTGGCCCCATTGG
CACAGAACGATCACAGCGTACAGACCGAGGCTCAGAGCCTGGGCCCCTCCGGCCATGCCA
TCGACCTGGCCCCTCGGTCCAGTTTGGCACTAGCGACAAGGTGTGCATGCATGGATCTGG
GTATCTGGTTTGGGTGGAGAGAAGGGAAAGGTTCGAGGTAAGACATAGACGACACATGTC
TAAATACTGGGACAATCTCTTCTGACTTGTGATCACAGGATTCAGACTTACGCCTAATGG
TAGGAGACACTTTAAAAGCAGAGAAGGAGCTAACAGCATCAGTCACTGAGGTAAGTGGAA
ATAAGTTTAGTGGGAAGGAAGGTCTGAGAGCTGCGGGGGAGCAACTTAGGCATTCAGGAT
GCCAGACATTGGCCTCTTTCTTCCTAGGCCATTCCTATATCCCGAGACTGGGAGCTGCTC
CCCAGTGCTTCTGCCTCAGCTGAGCCACAATCTAAGAACCTGGGTTCTGGGCATTGTGGC
CCAGAGCCCAGCTCCTCAGGCCAGCGCCTATACCCTGAGGTCTTCTATGGCAGTCCTGGG
CCTCCCAGTTCTCAGGTAGGCCCTACTTGTCATAGCTATCACATGACTTTTTCAGTAAAT
AATCATTCTTTTCTGCCTGCTATATTTTCTGATCAGGCCTATGTGGTAAAGTTGTAAAAC
CCCATTTTTTCGCCATATTTTTTACTGCTGTGGGTGAGATGGGTGATTTTTTTCTTGACA
AGAGAAACTAGAGCTATTTCAACTTGCTCTTCTGCAGGTCTCTGGGGGAGCCATGGACTC
TCAATTACATCCAAGCAGTGGAGGCTTCCGCCCTGGGACACCCTCACTGCACCCTTACAG
GTAATACTTGATTTGATGCCTGTAGATCTCAGAAAGAAATGAAGGTGTTTTAGGGCAGAG
GAAATGGGACTCTGTGAGTCTGGGTACAGTGGCTCATGCCTATAATTTTAGCACTCTAGG
AGGTTGAGGTGGGTAGAGCTTGAGCTCACTAGTTGGATACTAGCCTAAGCAAGAGCAAGA
CCCTATCTCTAAAAAATAGGTGGGCATTATGATGGGTGGCTGTAGTCCTAGCTACTCAGG
AGGCTGAGGAAAGAGGATCACTTAAGCCTGAGAGTTTGAGGTTGTTGTGAACTACGATGC
CATGGCACTGTACCAGGGTGACAGAAAAAGACTCGATCTGCACAAAAAAAATGAAATGGG
GACCCTCTGAACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAAATTTCTTGTTACAGATGCTT
CTACCCATGGTGGACTCACAGCTTCCAGTGGTGAACTTTGGCTCCCTGCCACCAGCACCG
CCTCCTGCCCCACCTCCCCTTTCTCTGTTACCTGTGGGGCCTACTCTGCAGCCCCCCAGC
CTGGCTGGGCGGCCCCCACCTGCTCCTGCTACTCGGGTGCTGCCTTCACCTGCCAGACCC
TTCCCCACTAGCTTGGGGCGGGCAGAGGTAAGGTACAGGAACTGAGATGCTAGGGAACTC
CGAAAGTTAAGTGTTAAGGATTCTGTATCTCAAGGCAGTAGGTTCATGAAATCTTTTTCC
TTCAGCTGCACCCAGTGGAACTAAAGCCGTTACAGGATTATCGAAAACTGAGCAGCAACC
TTGGAGGACATGGGTCATCACGTACTCCCCCAACTGGAAGGTAAAAGGGAATGGGGATGT
AGACTCCCAAAAGGTTTGCTTGGTTTGCAGCCAGGAGTTGGGTCTTAGGCTTGCCTTAAA
CACCCTTTTTCCCTTAGGTCCTTCTCTGGCCTCCATTCCCGTCTCAAGGCCCCACCTTCC
ACTTACAGTGGAGTCTTCCGTACCCAGCGCATCGACCTTTACCAGCAGGTGAAGGAGAAA
AACCCTGTGGCCCCAACTCTAAAAGCGTTACCACCTGAGGTCCTTCCATCCCATCCCTGA
CCTTACACTATGATTTACTCTTTCACACATGCCTGTGCCCTAGGCCTCACCACCAGATGC
CCTGCGTTGGATGCCAAAGCCTTGGGAGCGGACAGGGCCACCTTCTCGAGAAGGGCCTTC
CAGACGGGCAGAGGAGCCTGGGTCCCGAGGGGACAAGGAGCCTGGGTTGCCCCCACCCCG
CTGAGGGAGTTCCCTTACCCCCACCCCCACCCCCCAGGGCTTGTATATAGATTATAAATA
TATAAGGGGGAAAGGGGTGGGTGGGGAGGGGTTGTGGGGCTGGGGCCTCACTTCCCCTCC
TCCCCCTTTCCCTGGTCCCCTATCCCTGGGGCCGTTTGTTAAAAAAGAGTAATAAAAGGA
TTTAAAAAAAATTTCCAGAATCATTTAGGGAGGTGGGTTGTTTGGTGCTAAGTGAGGTAT
GGTTCATTTTTTCTGCAGGTTGGGAATTTGGGATTGGGCTCAGCTAGGTAAGCTGTTTAA
CTCCAGTTAAGTTACTGGTTTATAGCTGACACCTGGGCTAGGCCCAATATGGTTTCCTTC
AGTGTCTAGGGCCTTCCTTGTCTTTACATGGACTCTGCGGCAAGGTGTTCAGTCATCAGA
CCTATTAAGTGAGCCTGTTCTAAGAAGTTGAGGTAGACTACAAAGTGTATAACCAGGCCT
TAGGATGTTCTGCCACTTTCTACTGGTCTGGTGCTAAACTAGCCTTATTTATTTTGGTAA
TGGGGGTCTCTTGCTCAGACAGGTCTCAAACTTGTGAGCTCAGGCAATCCACCCCCCTTG
GCCTCCTAAGTGCTGGGATTACAGGCATGAGCCACTGCCCAGCCACTAAACAAGTTTTAG
AAGGGGAACAGACGTCAACTGCTTATTGGAACAGCAAAGAATTTGCAGCCATGGGGTTTG
GTCCTTCATGACAAACTAATGAGAGGAATTCCCTTTATAGGGTTCATGGCCTCAACATCA
GAGCATATTAACACTAGGCTCTTTGGCCAGGCATGGTGGGTCAAGCTGTAGGCCCAGTAC
TTTGGGAGGCAGAGGCAGGAGGATCACTTGAGGCCAGAAGTTCTACACAAGTGGACAATA
TGGACGCTGACTATCCTGAAGTTTAAAAAAATGGGATCTTTGAACAAAGTAGACCAAGTT
CTAGCATCATAAAACTTGAATTTCTTCCATCTCAAAAAAAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1885..2062, 2408..2507, 2590..2662, 3019..3162, 3323..3474, 3663..3742, 3887..4029, 4338..4339, 4341..4418, 4421..4422, 4532..4748, 5846..6320, 7091..7284, 7513..7810, 8177..8205, 8209..8214, 8217..8243, 8246..8263, 8266..8384, 8577..8958, 8964..8976, 8978..8982, 8984..8998, 9001..9003, 9008..9013, 9015..9056, 9059..9073, 9076..9108, 9111..9161, 9164..10425, 11186..11457, 11658..11788, 12064..12193, 12302..12387, 12580..12813, 12919..13059, 13178..13249, 13347..13514, 13717..13799, 14579..14789, 14890..14988, 15414..15626, 15725..15819, 15917..16007, 16123..16263
1001..1112, 1885..2062, 2408..2507, 2590..2662, 3019..3162, 3323..3474, 3663..3742, 3887..4029, 4338..4339, 4341..4418, 4421..4422, 4532..4748, 5846..6320, 7091..7284, 7513..7810, 8177..8205, 8209..8214, 8217..8243, 8246..8263, 8266..8384, 8577..8958, 8964..8976, 8978..8982, 8984..8998, 9001..9003, 9008..9013, 9015..9056, 9059..9073, 9076..9108, 9111..9161, 9164..10425, 11186..11457, 11658..11788, 12064..12193, 12302..12387, 12580..12813, 12919..13059, 13178..13249, 13347..13514, 13717..13799, 14579..14789, 14890..14988, 15414..15626, 15725..15819, 15917..16007, 16123..16260
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved