Otolemur_garnettii Locus AASDH
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii AASDH
Otolemur_garnettii
AASDH
GeneScaffold_1239
SNORA2
16011..16147
28788
CAGTTGAGCTACCGGCACCGAGCCATTTTACTTTTTCTAATCGATATTAAGAAACTTTT
TTAGAGACTGCTGATTAAGTGAGCTGCCAGTGAGTTCATTTAAATTTATTGTTTGCCCAG
TCTGAACTCTTAGCTTCAGGCCAACCTACATAAGCCTCTGGAGTAGCTGAAATTATAGGC
CTGGGCCACCATGCTGAAATTTAATTTTGGTTTTATAGACTGTTCCCATTTTCCATTTTC
AGTGGCAGCTCACCTGCTTCCAGATACTCTTAATAAACCTTTATTAACTCTATAAATAAA
TGCATTTGATTTTATTGCTTAATTTTTTTTTTTTTTTTTTTGGAGACAGAGCCTCAAGCT
GTCCCCCTGGGTAGAGTGCCATGGCATTACAGCTCATAGCAACCTCCAACTCCTGGGCTC
AAGCGAGTCTCCTTGCTCCGCCTCCCAAGTAGCTGGGACTACAGGCGCCCGCCACAACGC
CCAGCTATTTTTTGGTTGCAGCCATCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGA
ACCCGCCACCTTAGGTGTACGTGGCTGGCGCCTTAGCCGGTTGAGCTATAGGCGCCGAGC
CTTGCTTAATTTTTTTATGCATTGCCTCTCTTCTTTTGCCAGAGATGGAAAAAGATGTCT
CCTCTTTTTCACACTGTGGTCAGTTGACAGGGATGTCTACATTTCTGCCTGTTTCATTTT
CTTCTATGTATGCCACACCTCGCCCAGATTTTTTCCAAGCCCTAACCCAGCATTAGGGTC
AAATTAGTTTTCAACGTCATTGTTCTTAGTAACATTACTGTAGATGTTGCACAAGCTCGG
AGAGTCTTTATTTATGTGTCTTTGATATAATTACTTTGGTGAGGAATGGTTATAGAGAAG
TTTCTCCCTCCACTAAGCTCCCTATAACCCCCTTTTCCCCTAACATTTTTGTATATCTGT
AGAGTTCTCGGTTACAAGTCATTTAGATGAACTTCAGTGAAATGACTCTTCAGGAATTGG
TGCACCAGGCTGCCTCTCTTTATTTGGACAAAGTAGCTGTGTGTTTTGATGAATGTAACA
ACCAGCCTCCACTTTGTTGTACCTATAAGACTGTGGTTACTGATGCTTCGGGATTATCAA
ATTTTCTCCTATCACACTGTGACTTCGAAGGAATTCGAGAAATTGGTCTCTACTGCCAGC
CTGGGATTAATTTACCCTCTTGGATTTTAGGGTAATATTTTTTGGAACTATAAATTTGAT
ATTACTCTACGCTAATTTATAGTTTATTAATAGAATATATTGCAAGTCACTGTTTTGTTT
ACTATTAGATTTTTCTACATTTGGTCAATTTGAGAGAGGCTGAAGGAGTTCACATTTCCC
CTAGTGGTATTTTTAAGTATTTAAATTAATTATTCTGGACTCGGTGCCCATGCACAGTGG
TTACAGCTCCAGCCACATACACCATACACTGAGGCTGGCAGGTTTGATTCTGGCCAGGCA
GGCTAAACAACAATGACAACTGCAACAAAAAACAGCCAGGCGTCATGGCGGGTACCTGTA
GTCCCAGCTACTTGGGAGGATGAGGCAAGAGAATCGCTTAAGCCCAAGAGTTTGAGGTTG
CTATGAGCTGTGACGCCATGTCACTCTACTGAGGGTGACATTTTTGAGACTGTGTCTCAA
AAAAAAAAAAAAAATTATTCTGAACTTAGGAGAGACTAGAACTTTTCATTAATAGACCAT
TTAAATATTTCCAAAATGTAAGGGCATCATTTGTCTGTTAAAGGAAAACAGTTGTAACAG
TTTATAAGTTTGTTGTTACATCAGAGAAAATAGAGATTTCATAAATAAATTGACTATCTC
CTCCTAGCTCTCAGCCTCATCCCCAGACTGAAATTTTAGGTACTCAGCTGTTCAGTAAAT
GAAAGAAGAAGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAC
ATAAAAACAACTTGAAAGTTTTTTCCCCCTTACGATATCCTGGTTTGGTGAAATAGGTCT
CATATGAATCTCCATGCCCTGAAAGTTGCATGGGGATATTTGGCTTCTTTTGTGTTATCT
TACATAGGCAGATGAAGAATTAGACTCTGCTACCTGTTTCGTGTTTTAGGAGTGACCAAT
TAAGCAAGTGCATCACACTATCATACATTAACTTTAAAAAATCTTACAATTCTCTATAGT
GAGTCATAAAAATTTAATATTGTAACTACTTAAATACTCATTCAGAGCAAGATAAAAAAA
CTATAATCAGATATGTGTCAGTGAAAACACTGGAAATTTCTGATAAACAGTAAAGTGCAT
AGAGAAATAGAAATGCATAAAGGAAGATCATTTTCAACAGGCATTTTATGCTGACTCTGT
GTTTGTTTCTTCAGAATTCTCCAAGTCCCTGCTGCTTATGCGCCTATTGATCCGGATTTA
CCATCATCACTATCAACTTATTTTATGAAAAAATGTAACCTAAAGTACATCCTTGTTGAA
AAAAAGCAAATTAATGTAAGTCTGGGTGTTTAAATGGGCTTTTCTTGTGTGTTACATTTT
ATCTTTCATTTGAAGGATTCCCTTCTGTTCCCATCTTGAAGTCTAATTTACTAAATCTGG
CATGGTCTTTCGGTCTCAGCTCTCTTGACATTTAGTTATTGAGTAACTTTTGTAAGGAGT
GTCCTGTACATTATGGGATGTTTAGCATTATCTTTGGCCTCCACTTATTAGATGCCAGTA
TCACCTCCTGATTGTGACAACCAAAACTGTCTCTAGACATTGCCATATGTCCCCTGGACA
TACCCTTCACCTCCCATACTTCATCAAGAACCACCACTCTCTGGTGTAAACATCTCTATT
AGTCTTATAATGTGTTATGTATGGTTTTGAATTTCTTTTTTTAAACTATTTCCTGTGCTA
AAAAAAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TATTAATGATGTTATTATGACTGCATATAGTGAGAAGTGGTCATTCAGCAAAATCCTGTA
GAAAGTCTCTTGCTCCCTATTCTGTGATTTTGGTGATGGGTGTAAGTGATCTTTCTTCAT
TTAACACAGGAGCAATCAGCAGACATTTATTGAGTATCTGTTATATACCCAGCATCCATT
AGAGCAGTGGTTCACAACTGGGGACAGTTTTGCTTCCATGGAGACATTTGGCAATGTCTA
GAGATATTTTTTGTTGTAATGATAGAAGTGGGCTGCTACTGGCATCTAGTGGGTCGTGGC
CAAAGATGCTGGTAAAAATCCTACAGTGTGTAAGACAGCACCCCACAAAGAATAATCTGG
TCCATAGTGTCAGTAGTATTGAAGTTGAGAAACCCAGCACTGGGGACAGGGTGATTGGGG
AGGAACTCATATGTGAGCCTTCCAGCTTCTTATAATGTAATACTCCTTACATTACTCCTT
AATACTCCTGAGCCTATAAGGTCCACTTAGTGTCGGCCCAGGTGGTAAGACATTGTTCTA
AGTGAGGTAAATGTAGCCTAGTACGTATAGTAAAATTTTAATGGTAGAAGGATGATTTTG
AACTAAATCTTAAGAATATATAGGCCTTCAGTTTTTTAAACATTATAGGCCACACCGTAT
CTCCCCTCCTGATACAAACACATACAATAACTACACAGACACAGAAAACACTACAGGCTC
CTGGGCTGTGACTTTTTTCTCTTGATATATTAATTTCTTTAATGTGAAAACTTAAGGTGT
AGTTCATTAAGATGGTTTTAAATCAGCTTAAGAAGTGTATTCCAAGGAACTCACTTTCAA
CATGACAGACTGAATCTAGCATCTCCTTATCCAGACTCACTTTTGCATTAATTCATTCCA
TCCACAATTCATCTGAGTCAAAAACCCAGCAATCTTCTTAGACTCACTTAGAAAGTCACC
GTGCCTTACTGGTTCTTTACCCTTTCTCGTCGCATCCCTCGGGCCCCTATGGCCCTGGTC
TCGAGCCCTTTAGGAAGGAACCAGGCATGATGCGGACTAGAAGTACAAGCTTGTAGGAGG
CGGGCTAGCCCTTCTTTGCAGAGTAGCCTCAAGCAACCGCCACACCAGCCTTTTATTGAG
CCCGAACAACACAGGTGAGGGGAGTAATTAACAAGGACTACATGCTGCAGGCTTAGGCTC
TTTCTCCACAAGGAACATCTGCAGACGAATGGCCCGAGGGTCCAACCCCCCAGCTGCAAA
TCATCTTGCTCAGAGGTCATCTGGCTCTTGGCGTCCTCTACACTTTCTGACCACTCCTGT
TACAACAGAGTAGTTCAGTCCCTTGTAGCATATCTGAATTCTTACAAAAGATTAGTTAAA
TGGCTCCTAACAGAGTCTTGTTTATGCTTCTGTCTTTGGTGGAGTCCAGTCTAATCTATG
TTGTCACCACCTTCAGGTGGAAGGTGATGGAATCTCCTTAGAGGGTGAGGTCTGAGCCCA
GGAGTGCTGAGCAGACAGCGTTACTAAAGATTTGCATCTCATCTCATGGATCAACAGCCT
AACTCCCGTTGTCCCTCTCCCACCTCTGTACCTTATTACAGTGTTTAATGTTCTCCACGG
TATCTGCTTTCTCAGATCAGATATTTCATGTTGGCTGTTTGTCTAAAGTGCCCATTTTCA
TTATTTAGAGAATCTCGACTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGGTCTTCCTTTGAAACGCTATTGAACT
ACGATCCATTTACAGTTGAACATAATGGCCTCGTACTCTTCACACTTCGGTGGAAACACG
GAGAGGTGAACTTGATGCTGAGTGACAGAAAAGAGCACTGTGAAAAGGAAGCGATAACAG
ACAGCGTAAGTTCCGAGAACTGCGATGAAGAAAAAGCAGAACACATGGACGTGAGGCGAA
AGCATTGCTTAGCCTACGTTCTCCACACCTCAGGGACTACAGGGGTGCCGAAGGTCGTCA
GAGTGCCTCATGAGTGTATAGTGCCAAATATCCAGCATTTCCGGTAAGCTCCATTCTTTT
AATCCTTAGAACTTGAATTTTTTTTTTTTTTCTTTTGGCTGGGGCTGGGTTTGAACCCGC
CACCTCCAGCATACGGGACCAGCGCCCTACCCTTTTGAGCCACAGGTGCTGCCCAGAACT
TGAATTTTAAAGGAAGAAAAATTTTAAGATACTTGTTTTTAACTCTAGTTCCTAAATTGA
TCGTCCTAAGTAATTGAGTCTCTTGTTTCAGCTCTAGTTGAACTTTAGTTCTTTTTCTGG
CAGAAGTACCTGCTGGGGTATGAGAAAAAAGAGTCTGTTGGTCCTACTAGGAAGTGTCCA
GGGCAGGGCTGAGGAAATAGAAGGAGAGCAGGAATTTAGCCCAGTAGGTGATAAAGAGCT
ATTAAGGGATTTGCATTGCATTAAATTCACTCTTGCAGGCTTGGTGCCCATAGCACAGTG
GTTACAGTGCCAGCCGCATGCACCGAGCTTGGCGGGGTTGAACCCGGCAACTAAACAACA
ATGACAACTGCAACAAGAAAATAACTGGCTGTTGTGGTGGTGCCTATGGTCCCAGCTACT
TGGGAGGCTGAGGCAAGAGAATCACATAAGCCCAAGAGTTTGAGGGTGCGGTGAGCTGTG
ACATCACAGCGCTCTACAGAGGGTGACATAATGAGACTCTGTCTTAAAAAAAAAAAAAAG
TATTCTACTTTTAGAATGATTAGCTGTACCCTTTTTAAGATAAACCAGAGAGGCTCGGCG
CCTATAGCTCAACCGGCTAAGGCGCCAGCACGTACACCTAAGGTGGCAGGTTCGAAATCC
CCAGCCCGGACCTGCCAAACAACAATGACGGCTGCAACCAAAAAATAGCCGGGCGTTGTG
GCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCAGAGGCAGGAGACTCGCTTGAGCCCAG
GAGTTGGAGGTTGCTGTGAGCTGTAATGCCATAGCACTCTACCCAGGGGGACAGCTTGAG
GCTCTGTCTCAAAAAAAAAAAAAAAAAAGATAAACCAGAGAGGTGATAACTCTTGATGAA
GGTGTAATGGTCTGTCTTTCTTCGTCAGTGGCCGTAAAACTCTTCCCCAGAGAGTGTTTC
CTGGTAGGTTTCCTCTTCGTCTTCCTGGGAGCTGAAACACTTTGAATGAAGAAGAGGTTT
TTAGAAGCCTCACTCCCCCGAAGTTTCTGCTTTTGGTCAAATAAAAGAAGCTCCAAGAAG
ATTTTTTTCTACATCTGTTGACTCTCAAATGTCTTTAGCTTAGTCTTCATAGCAGCTCTG
GGGTTCCTAGTGGGTCCTCATGTAACCGTACCTGCTTCCTAGGGTGGTTGGGAAAATGAG
AAACAGTCCATTAGGGACCCAGCACTGAGTCACATGTAGCACGATCAGACATTTGCTTCA
TTCCATCATTTTTCCTCCTTTAAGATCTGTCTCTTCTCTTTTCTCAACCTTTCTTGTATT
GAATGCGTCTTAAGCTGCTTTCTTGAAATTCAGTGCCTTGGAGCATGCATCACATTGCCC
GTGTTTGTTCATACAGTGGAGACAGTGAGAATTATGTTCAGGGTTATGCTTTGTTGAACG
CCTGTTAGAAAGTTTATTCTCCCCTAAATGTGTGTCTAGGAAATCACACAATATGTGCAA
AGAATAATTCCCTTAAAACTTGAAGTTTGAGTGTAGCCTTTGTCGGACTCAGCAATTGAT
GTCCCAGAGTGTGCCCTTTTAGTACCTGGAGCACTTCAAAGTGAAGGGCATTGGAAAGGC
CTTAGAACAAAGTCTCTTTTCTGACCTTTTCCTGCACTCTTTTTTCCTGCTTCCTTCACC
CCAAGGCCGCCCACTGAGACTAGAATCCTTCTTCCTAGGGGAACGTCATAGAAACCAGAA
TACTTTCTCCCCTAAAGCCAGCCATAAAACTTAGAAATATTACTCTAACCTTCCCCTACC
TTTCTGTGTAGGAGCTTGCCATAAAGAAATTCTCTGACCTACCTGGTCTGAAAGTAGATG
ATAAGACTCTTACTCCAGAAAGGTCTGCCCTGTACCCAGGAGGAAGGAATGCTACACAGA
TAGATCAAGAAGAATTTAAACAGGCTGAGCACAGAGGCTCACACCTACAGTCCTAGCACT
CTGGGATGCCAAGACCAGGGGGATTGCTTGAGACCAGGAGTTTGAGACCAGCCTGAGAAA
GGAGACCAGCTCCCTCTCTATAAAAAAATTAGCTGGGTTTGGTGGTACCTGCCTGTAGTC
TCAGCTAGTTGGGAGGCTGAGGCAGGGGAGTTGCTTGAGCCAGGGGATTGAGGTTGCATT
CTAGTTCAGGTAACAGAGCAGACTGTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTG
AGACAGAGTCTCACTTTATTGCCCTTAGTAGAGTGCTGTGGTGTCATAGCAACCTCCAAC
TCCTGGGTGTAGGCAATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGGACTATCTTTCAAC
CCTTTTTTAAAGGCCTTCCAAGTAAATCCAGGCAACCCAGCACGATCTTCAGTTGCTTAA
TTTAAAACCAGCCTATTCAGGGCTTTGGGGTCTGATTGAATTACTGCTTGGAGGAGGAGT
GTGACAGGTCAAGAGACTATCCTTTCTCTCCCACCTTAATGGAAAACAAGTCAGAGAGGG
AATTCTGGGGACTGGAGTTCGGTCAGTCCAAACAGATTGACACATCAGAAAGTCATCACA
GATGATAAAGTGTGCCTGGTAAAAAGGGATTATTGTTTTAAATGGCTTTTATTCTTTGTA
AAGAGAATTTCCTGAATTGATAGCAACATTTTGGTTAATTTAAAAGAAAAGTTTGGGATC
AGTGGCTCTTGCCTATAATCCCAGCACTCTGGGAGATGGATTGCTTGAGTTCAGAGGTTG
GAGACCAGCCTGAACAAGAGCGAAACCCCCTTCTCTATAAACATAAAAGATTCGCTGGGT
GTTGTGGCAGATGCCATTGTCCCAGGTCCTCAGGAAGCTGAGGAAGGAGGATCACTTAAG
CCTAGGAGTTTGAGGTTGCTGTGAGCTACGATGATGCCACGGCACTCTACCAAGAGTGAG
ATTCTGTAAATAAATAAGTCTGGCTTAACGTTCAGAAACTTAATCACCATAAGCATAAAC
CATAAACACTTCTTTAGAATAGATGTTTGTCAAATGTTTGACGTTTCTCATAACGACCTT
CTGTTTTGCCTCAGGATACTTTTTGACGTCACACAAGAAGATATTTTATTTCTGGCTTCA
CCTCTGACCTTTGATCCTTCTGTTGTGGAAATATTTGTTGCCTTATCGAGTGGTGCCACT
CTGCTCATTGTGCCAACTGTTGTCAAGGCGCGCCCATCACAGTTAGCTTCCGTTCTCTTT
TCCCATCACCGAGTGACTGTGTTGCAGGTACATTTGGGGAGCAAATGAAATGTTTTGTTT
TTCTTTAGTCAGCATTTTAAATGTTGTAGAGAATGTTTTGTCCTATAGGTCTTTACATCG
GATTAACTACCGTTACCTATTTCCTCAAGATGCCCCTTTTTTGGTGAAAATGAAAAATAC
AACTGGATCTATCCTCACTGTTCTAGTAGGGCAAATACTGTATCTGTTAGACAGAGTTCT
CCTATCTCTTCTCTCCTCATGGGGAAAAAAAGAAAAAAGAAAACAAAAAATAATCAGCTA
ATTCTAACTAGATAATTGTTTGACCACGTATTTTTTGCATACTGTAATAACCAGAGTAAC
TTCACTTTGACACAGATCTGGTATGATATGCTGTCTCTTCTGTTTTAAAATTTACATGTA
TTGCGGTTCTGACTAAAAGCTAGTGCAAGTAAATTAAACCACAGTTGAGTTTTAAGAACA
TAGATTTTCTGATTTTGACATCAGTATATTGTACATTATCCTTCAGAAACAAGTATTTTT
TAAATTTGGCCTTTTAATAAATTTTAAAAATGTGTATCTGAAAATCCATGACTGGGACTT
GAGCCTTACGATATATTACGTTGTAAGTAGAGATACTAGAGAGAACTAAGCCAAAATAAC
TCGCATATCATGAATATATGGCCGTGTAAGTTAGGTGTTTCAACTGCTGTAAGCCTCAAA
TTTTGTCTGTAAAGGGAAAATAATATTCATCTCAAAATAGTTGAAGAATTAAATGAGAGC
GTATAATAGTTCCGGGTGTGGGGGGTATGTGTGTCTTAGTCTGTTTGGTCTGCCATAACA
AAACACATAAACTATCCTTTTTTATTAAGGAAAAATTCTGACAGCAAAACTAAAATATTT
ATAGCACTAAAAATTATAAAATAGGAATAAACTTAAAGAAGAGCAAGACTTATATACTGA
AAACTATAATTATTGATAGAAATTAAAAACCTAAATAGAGAGGCATTTTGTGTTTATGGA
TTCGGAGTTTTAATAGTTCAGATTGCAGTTCTCTCCAAATTGAATATAGCCCCTAGTAAA
AGCCCAGCGGACTTTTTTTGTAGAAATTGATAACTTGTTCCTAAGTTTTACATGGAAATG
CAAAGCCAGTCTTGACCCACAAAACTAGACTGTACAACAATAAAAAGGAGTGTACTTCGC
AGCAACATAGAATTGCATCTGTTATCTTGACTAAAAGAAGCCGGGACACAACAGAGTACA
TGTATGATTCCATTTATGCAAATGGAATATACAGTTTCCGTTTAGAATTGTATCTGTAAT
TTATTAAATGAAATCATTCAACATACCAGCTGGTCTGTAGTGTCAGAAAATGCTTCAGTG
GTTGTCTGCAGAAAGAGTGCAGTTGGAGAGAAGAATCGCAGTGGTGCCCAGTGATTAAGG
GTGATAGATGTTGGCATGGGCTGATGTTTGTGTTCCTCCAGAAACGGTGTGTTGAAATCT
AATCCCCAGTGTGCTGGTATTAAGGTGTGGAGCCTTTAGGACATGAGCTGGTCTTGAGGT
TGGGGCCTTTGTGAATAGGATTAATGCCCTCAAAAAAGAAGCCTGAGAGCCGGGCACAGT
AGCGTCTGCCTGGAATCCCAGCTGCTCTGGAGGCTGAGGCAGGGGATTGCTTGAGCTCAG
GGGTACAAGACCAGCCTGGGAAACACAGTGAGACCCCACCACCACCACCAAAAAAAGGAA
AGAGGCCTGAGGTTGCTTGTTTGTTCCTTTTACCATGTGAGGACGCAGCAAGAAGGTGCC
ATCTCTGAAGCATTCCACGCCCTCACCAGACACTGGAGCTGCTAGCACCTTGATTTGGGG
TGTCTCAGCTTCCAGAACTATGAGCAGTACATTTCTGTTGTTTATAAGTTACCCAGTCTG
TGTAAATTTTGTTAGACTGAGATAGATACATTCATTATTTGGCTGTGGTGATGGTTTAAT
GGCATATACGTATATCAAAACTTGTGATAAATTGTACGCTTAAAATAGGACACAGTTGTA
TCTCAATAATGCTGTTGCTAAAAATCTTTATTCATATTTCTTTGCTTAGACACATTTTAT
TTTTTTTTTTTTTTGAGACAGAGTCTCAAGCTGTCCCCCTGGGTTGAGTACCATGGCATC
ATCATAGCTCAGCACAATCTCAAACTCTTGGGCTCAAGCAATCTTCTTGCCTCCATTTTA
GTATTTTTAGTAGAGACGGGTCTCACTGTTGCTCAGGCTGAGCTCAAGTACTGCACCTGC
CATGGCCTCCTAGAGTAAGTACTAGAGTAAGTACTAGGAGATTACAGCTTGAGCCATCGC
ACCCTTAGACACACTTTTAACCCTTTAATACACTTTTTCTACATAGAGCAAATGGGAAAG
AAAATATAAATTGATTTTTTAGATTTTGTCTTTTTTATCTTTAAGCCTTTTTGTGTAAAC
TGTGTAATGAAACGTAACTAATGTTTCTGCTTAAGCTTTCTTCTAAAGCATAACCGATAC
CCACATTAATAAGATAACCCTGCTTCAGTTTTTCAGATGTGATTTGCCATTTAATAAACA
TAGTCTTAATTTCTGTGTGGGCTTTCAACAAATCATTACGGGGTTTACATTTTTAAAGAA
GTGAGAGGAAAGAGATTATTTTTAATATATCTATAGGCAACGCCAACATTGCTTAGAAGA
TTCGGAGCTCAGCTTATCAAATCCAGTGTTTTGTCAGCCAGTACTTCCCTTCGAGTGTTA
GCTCTTGGTGGCGAAGCCTTTCCGTCATTGACTGTCCTCAGAAGCTGGAGAGGAGAAGGC
AACAAAACACACATATTTAATGTCTATGGAATCACAGAAGTATCGAGTTGGGCGACCTTT
TACAGGATTCCAGAGAAGAGTCTTACCTCTACTTTGAAGTAAGAGTTTCGATTATGTATG
CTAAAAAGAAAGATGAGAAACTATGTATTTCCAGCATCTTAATACCAACAGTGTTTTTGA
TAGGCAGTAGGCTAATAATTGTAGAAAACCTGTTTTACCCAGTACGTGTATTTTAAATTG
GGATCCAAAACCTTTCTTATTATAGCTGGTGCTGAGATCTTGCTAGAATTGTTTGTAACT
GAACAAAAATGGATAATATACATGATAACCTTTCCATCTAATCTTTTCCTCTTGGCTTTG
AATCATAACAAACTTTTCTTTTTTCTTTATAGTGTGATTTAAATACATTGGGAAATACTC
TTTTCGAATTAAAAATTTTAAATCTGCTTTGGGTTGTGTTTTTCGTAGATGTGAAATGCC
TGTACAACTGGGATTTCCACTGCTTGGAACAGTAGTTGAAGTCAGAGATACTAATGGTTG
CACAATTCAAGAAGGCAATGGCCAAGTATTTTTAGGTTGTTTTTTTTTATTCATTGAGGA
TAATTTTTCTTTAAAAAAAGAAATCTGATATGTTAATTTTGTTGTTGTTCTGCTTTTCTT
ATGACTAGTATGCTATTCAGTGATAAGTTTTTTTTTTGGTTGTTTGTTTTTTTTAGAGAT
AGAGTCTCTGTCACTCATGCAGGAGTATAGTGGTCCCAGTCATAGGTTACTCCAACCCAA
GGGCTCAAACAGTCCTCCTGCTTCAGCCTCCCAAGTAGCTAGGGCTACAGGCATGTGCCA
CCACACCTTGCTACTTTTTAAAAATATTTTAAGAGATGGGGTCTCACTGTGTTGCCCAGG
GTGACCTCAAACCCCTGACCCCAAGTGATCGTTCTGCCTCAGCCTACCAAAGTACTGATT
TTATAGGCCTGGGCCACTATGTCCAATTGATAATTTTTAATCTCAATCTGATAGTCATGA
AGCATTGAATAACTTACCATAGTTATTTCAGCTAACAATGTCTAATACTCTTAATAAAAA
TATTTAGAAACTGTAACTTACACCTTTATATATTTATACTTACAGCCAAAGTTACATTTA
ATCAGTATTCTAAGAATTTTTTAAATCCCGTGTATGTTTTTAGAAATAAATTTTATCTTA
TCCCTTTGCTTAATTATTGAGGTTATTGTGTCTAATTTTATCAGAAAACACGTAAAAGTG
AGCTCCCCTTTTAATATAAATACTCAAATTTTGAAGCTTCGTAACAACTTTCAGAGATGT
CGATTCGATGATTTTGAAGATATTACTCAAGATTTTTATGACATTGGTGTTTATGTCTTG
GGCAGGTGGTGGAAGCAGAGTGTGTTTTCTTGATGATGAAGTGACAGTACCACTTGGCAC
AATGCGAGCCACAGGAGACTTTGTGACTGTGAAAGATGGAGAGATATTTTTCTTGGGACG
AAAGGACAGTCAGATCAAACGTCACGGCAAACGTCTTAACATTGAACTTGTGCAACAGGT
AGAACAACATAAATCTTAAATATCTGTTAGCACATGTCTGTATGAGAAGCAGCCACCACC
AATTTTTTACGCCAGGGTTCTTCATTATTTACACCTGAGATTTTTATGTTAATCATGAAT
TACGGGAAAAGGTATGGGTAATTCATTGTGCTTCTTAGATCCAGCATGCAGAGATGGTTA
TTCCTTAAATAAGTGACAAATGGATTCTGAGATCTGTGAAAATAAATGGACTTATTTTAC
TTTAAGACCTGTTATTTTTGAAAAATATTAAGAACAGTGTGTGCTAATAGTACTAAAGTA
CCAAACAATTTTTAAAAAAATCTCTAGTATATATCAAAATTTAATTAAACTATTTTGATT
TCACACATTATAAAAAAAATGAGTGTTGGGCGGCACCTGTGGTTCAGTGAGTGGGGCACC
AGCCCCGGCCAAACTGCAATGGAAAGATGGCTGGACATTGTGGCAGGTGCCTGTGGTCCC
AGCTACTAAGGAGGCTGAGGCAGGAAAATTGCCTGGGTCTGGGAGCTGGAGGTTGCTGTG
AGCTGTGATACAACGGCACTCTACCAAGGGCAACAACATGAGACTCTGCCTCTAAAAAAA
AAAAGAACATTTAGAAGCTTGTTTTGAAATGTCCTCATTGGCAATTGGGATAATCTCTCT
TACAGGTTGCTGAAGAACTTGAGGAAGTGGAATCTTGTGCAGTTACATGGTATAAACAGG
AAAAGTTGATTCTCTTCATTGTATCCAAAGATAATTTAGTAAAGGATTACATCTTTAAAG
AACTGCAGAAACATCTTCCAAGTCATGCAATCCCAGATGAACTTGTGTTGATCGATGCAC
TGCCATTTACATCTCATGGTAAAATAATTAAAGCAGATATGTTTCATTGCCAAATAATGC
TGATTGTATCCCTAATTGGTTAATGGTCCCATATATCTTTATTATAAATGATGCTAACAT
TTCTTATGATAGACTTTCTATTACATGCTTTGCATAATTAATTCCTTTCATCTTCAGAAA
ATCCTGTTGGTGGTGGTAATATTTCTATTTACAGATGAGGAAAATAAACCTTCAAGAAGT
TAAGCCATTAACTTAATGTTAGTACACTGTAGCACCTACAGTACCAGCTACTCAGGAGGC
TGACGTGGACGGATGTCTTGAGGCCAGGAGTTCGAGACTGCAGTGTGCTATGAGCACACC
TGTGAACAGCCACTGCACTCCAGTTGAGCCAACAATAGTGAGATCCCTATCTCAAAAAAA
AAAAAAAAACCTAAGTAATTTTCCCAAAATCATTTCGCTAGGCAGTGGTTAGAGTAGGTA
GGGTACTCCAGAGAAACAGAGTAAATATACATGGATGGAGATATGTAAAAAGGAGGGATT
AGGGGCAGCACCTGTGGCTCAAAGGAGTAGGGCGCTGGTCCCATATACCAGAGGTGGCAG
ATTCAAACCCAGCCATGGCCAAAAACTGAAAAATTAAAAAAAGGCAGGATTAGTTCATGT
GACTGTGGAGATTATAAAATTCAGTGATCTGCTGTCTGCAAGCTGGAGACCCAGGAAAGC
TGGTGGTGTAGTGAAGGTGAAGTTAAGCCTGAATCCTAAGGCCTGAGAACCAGGGGAAGT
GATGCTATAAATCCTAGTTCAAGGGCAGAAGAAGATGAGATGAGATGTCACAGTATAAGC
AATGACGAGGAAAAAATTGGAAAGAGGGCAAATTTTTTGTTTCTTTGCCTTTTTTTCTAT
TCAGATATTCAGCATACTGGATGATCCCAACCACTTTGGGGAGGCCAGTCTACTTCACTG
ACTCTGCCTATTCACATTCTAACCTGGTCCAGAGGCATTCTCCCAAACACAGCCAGAAAC
AATGTTTAATCTGGCGCCCTAGCCCACTCAAATTGACATGTAAAATTAGCCATCACAGTG
GCAGAATTGCAATTCTGTCTAGAACTGTTTCACTAAAATATAGGCTCTTAGTTGGCCCTG
AATCAAGGCCAGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGAGCCTAAAGAATTATCT
TTCTATGGTCTGTTGGCCATTTCAGAACTTTGAAAATGTAATGGTCAATTCATTAGAAAG
AAACAGTATGCCTCAGTGCCCATAGCTCAATGAGTAGGGCACCGGCCACATACACCAAGG
TTAGCGGGTTCCAACTTGGCCCAGACCAGCTAAAAACAACAATAACAGGGCAGCACCTGT
GGCTCAGTAAGTAGGGCACTGGCCCCATATACCGAGGGTGGCGGGCTCAAACCCGGCCCA
TGCCAAACTGCAACAAAAAAATAGCCAAGACTTGGGGACTGTGGCTCAAGTGGCTAAGGC
ACCAGCCACATACATCTAAGGTGGTGGGTTCAAATCCAGCTTGGGCCCGCCAAACAACAG
TGACAGCTGCAACCAAAAAATAGCTGGGCGTTGTAGCAGGCACCTGTGGTCCCAGCTACT
TGGGAAGTGGAGGCAGGAGCCTCACTTGAGCCCAGAAGTTGGCGGTTGCTGTGAGCTGTG
ATGTGACAGCACTCTACCCAGGGAGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAA
ATAGCCAGGCATTGTGGCAGGTGCCTGTAGTCCTAGCTACTCTGGAGGCTGAGGCAAGAG
AATCACCTAAACCCAAGAGTTGGAGGTTGCTGTGAGCTGTGATAGCATGGCACTCTATTG
AGGGCAACAAAGTGAGACTGTTTCTGAAAAAAAAAAACAATGACAACTGCAACAACAACA
AAAAAACAGCCAGGCATTGTGGTGGGTACCTGTAGTCCCAAATACTCAGGAGACTGAGGC
AAGAGAATCACTTTAGCCCAAGAGTTTGAGGTTGCTGTGAGCTATAACACTACAGGCACT
ACCAATGGCAACATAGTGACACTTTGTCTCACAAAAACAAACAAACAGTATGAGTCATTG
GTGATGAATGTGGGTTAGCATTTTATTTGTAGTCTTAATACTGGGGGTCCAAAATATCCA
TAAAATATTTATCTCATCAGTGGCAGAGCATTTTGAGTGTATAAAATACTATATTTTATC
TCAAGAGGATATTTAAGGTATTCCTTAAATGGTAATGTTGTTTTATCTTATTATAGTCCC
CCCCCAGAATTACTGTGGGTTTTCACCCAAAATAAAGAGATGATTCTACAGATGGAAAAA
AAAAGGACTTTTTAATTAATCATATAATATGGCTTTCCCAATTCCGTATTTAATTTAAAA
AAAACGTAAAAAAGGAAGGAATCCCTCAGTTAACGGAACCATTCCTTTAGAGCTTTAATT
TATGTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTCCCCCCC
CAGATTACTGTGAGTTTCACCCAAAATAAAAAAGATGATTCTACAGTATGAAAAAAAAAA
AGACTTTTAATTATCATATTATATTGCCCTTCCAATTCCCATTTTTATTTAACATATACT
TAAAAATGTAGTAATCCCTCAGTTAACGGAACCATTCCCTTTAGCTTTTATTTTTTTTTA
TTTTTATTTTTATTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCCGT
GGCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCTTGCCTCCGCC
TCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGCTATTTTTTGGTTGCAGC
CGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCACCACCTTAGGTGTACGT
GGCTGGCGCCTTAGCCCGGTGAGCTATAGGCGCCGAGCCCCTTTAGCTTTTAAATTTGAC
AAACATTAGCTCCTGCTTTTCTATGTTCTTACCTGTTATTCTACATTCTTGGTAGAATCA
GACTACTTTGTTTAGAATTGATTATTATGACAAACTCTTTATTCTATAGGATTTCTAAGC
TTTACAGTGAAAAATGTATGTGATCCAGGAACATGTAAAGGCTTTGAGGTGAAATTTAAA
AATGTTATCTTGAGACATTTGTTATTTCTCTCTTATATTAAGGCAAGATTGATGTTTCTG
AGTTAAACAAGTTATATTTAAACTACATAAACTTGAAGTCTGAGTATAAGCTCAATGGAA
AAGAGGAACTTTGGGAAAAATTACAGTATTTGTGGAAGGTACAACTTTTTATTTTATTTT
ATTTTATTTATTTATTTTAGAGACAGAGTCTCACTACTTCACCCTCAGTAGAGTACTGTG
GCATCATAGCTCACAGCACTGAGCCTGGAGGGTTCAAACCCAGCCCAGGCTTGCTAAAAC
AACAGTGACAATTGCAACAAAAAATAGCTGGGCATTGTGGTAGGTGCCTGTAGTCCCAGC
TACTTGGGAGGCTGAGGCAAGAGAATCACCTAGGCCTAGGAGTTGGAGGTTGCTGTGAGC
TGTGACACGACAGCACTCTACACAGGGTGACAGCTTGAGACTCTGGCACACACACAAAAA
ATGTGTAAGTCTCAATTGGTTAAAAAATTTTCTTAGATAAAAAATCCTGAAAAAGGTTCT
AATTGTATAGTCTCAACTAAAAATAGAGCTTTATCCATTTCATTTTTAGATTATTGGCAA
GTAATTTTGGTTTATATGAAACAGATAAAGATAAATATTATTTCCATATTATAGAAATGT
CAGCAAATAGTATCTTATAGGCTTTATAATTAGTAAATCAGCTCTATTCCCAATTTTATG
GATAGGAAAACCTCTCTGAAAGAATGTACAGTAAGTTGACCACCCAATAGACTATAATAA
ACCAGTCAACAGGCTCGGCACCCATGCTCAGTGGTTAGGGTGCTGGCCATACACACTGGG
GCTGGCAGGTTCAAACCTGGCCTGGGCCCGCTAAACAACAATGACAACTACAACAAATAA
ATAGCTGGGCATTGTGGCAGGTGCCTATAGTTCCAGCTCCTTGGGAGGGTGAGACAAGAG
AATTGATTAAGCCCAAGAGTTTGAGGCTGCCGTGAATTGTGAAGCCACAGCACTCTACTG
AGGGTGACATAGTGAAACTCTGTGTCAAAAAAAGAAAAACAAAAAAACAGTCAATATTTG
GAGGTGGTCAGCATAAGACACTGGGCCCACTGTACTGATAGGTACATGTGCATGCTGGGT
TTGTGAAAATTAGATCAACTTAAGGAGGTGGTCAATGTAGCGAAGGGGTCAACTATGGAG
GTTTTACTATATATTTTCAGTTTTTGAGTGAGTTTATGACAAAATTGGTAGTATAGTGAT
ATTCTCTTTTAATGTAAAGAAAATAATGTAACAATTTATTATTAAAAATATTTATTTTGC
GTTTCTTGCATCATTAATGTAGTCACTGTCATCTCTGTATGTTACCTTTATGTCAACGTA
TTTCTCTCTTCTCTCATCTCTAGTCTATTCTGAGTCTCTCCGAAGATCTTTTGAAGGTTC
CTGATGAGTCATTCTTCTTAAATAGTGGTGGTGATTCCTTAAAGTCCCTACGACTCCTCA
ATGAGATTGAAAAACTTATTGGTGTGTCCGTACCTGGGCTTCTGGAAATGATTCTCAGCA
GTTCCCTTTTAGAGATTTACAATCACATTCTTCAAACGGTGTTTCCAGATGAAGATCTGA
CACCCGGCAAGAGTTGTGCCACAAAAAGGAAACTCAGTGACATTGATCAAGAGGAAGCTG
GTGGCAAATCTGTGCATCAGAAATCTGTCGTGCCTTTAAATTGCGACAATGAGATTAAGG
CTTTTGCACTCAGCAGAGGGAGTCAGGTTTCTTCTGTGGATCCTACTATGTCTTCAACTA
AGTTAGGAAACTGCCTTTCAGTCTGTTCTGATTTAACGTCACAGACTAACAGTCAGAATT
CAGAAAGCTTAAATCCTCCAGCTCTAATCAGGAAGTCAAAAGACCTATCCCTTGTTGCAG
AAGTTTCTGGAAAGGGCAAACCTGTGGCAGAGTCTGAGAAAACAGAGTTCTGCGTGCGGT
GGAGGTCGGACACTGGCAAATGCGTAGATGCTTCCCCACTAGTTGTGATACCAGCTTTTG
ATAAGTCCTCTGCGACTGTGTATATTGGTTCCCATTCTCACAGGATGAAGGCAGTTGACC
TTTACTCAGGGAAAGTGAAATGGGAACAGATTTTGGGAGATCGAATTGAATCTTCAGCAT
GTGTATCTAAGTGTGGAAACTTTATTATAGTGGGTAAGTTTTTGAATTTGAGGTTTGCAG
AGTTAAATTGAATCGCTCTATAATAATGCTGATAAGACCATGTTAAATTGAAAAAAAAAA
TCTATTTATGGTAGATTTGGTTCCTGCCAGAAAATAATAGTTAACCACGTGCTGATTAAT
AGTGTGGGCCTTGGATTGGAACCTCGTTCTATAGCTGTTCTGAGCTCTGTGACATTTGGC
AACTTGCTGAACCTCTTAGAACTTTTATTTTTCTTTTGGATAAAATGGGAGAAATAATAA
AACCTGTTGCATCACAAAGTACCCAAAAACCTAATGATCTATAGCAACAAACATTTATTA
TCTCATGGTCAGGAACTTAGGAGCATTTAGATGGCAGTTGTGGCTCTGGGTCTCATGTGG
CTGTAGCCACGTGAGTGCTTGACATGGTCTGGATAGTGTCTTTCTGAGATGGCTCCTTCA
CATGGCTGCAAGCAGAAAGCCTCAGTTCTGTGCCGGTTCACAAACCTCCCTGTAGACTGT
TTGAATGCTCTGCTACCATGGCAACTATCCTCACAGTGAAGGAGCCCAAAGAGCACAAGT
CAAGAGGAACCCAGTACTTTTTAGGAGCTGGTCTCCTAAATGCTGTGCCATTATTTTTGT
TTTATTCTGTTCATTCGAAATACATCGCTCGGTTCAATCCAGACTCAAGAGGAAGGAAGT
TAGGCTCTAAAACCATCAGAATTATCATGGAGCTTTGGGGAGAATTAAGTGGATAATGTC
TTGTGCATTATTTCCTTGTTCTGCAGAAAAATAATTTGAGGCTCAGCAATGCTAGGGAAT
TTGCCCAGTGATGGACATAATGAGATTTGAAACCAGACGTTTCAAAGCTGTCTACCACAG
TATGCATTATTATTTTCTCAGTAGTGAAGGACTTTAAAAAAAATAAGGCATGTGTGATTA
CTGTTCAGTTTCTGCTTCACTCTACTGAAATTTAAATCAAACAAGCAGAACATAGAGATT
GCATACACGTGAACAGCCCTGAATATAAATTGTCATGATTTTGGCTAAAGAATTATTTTC
AAGTGACATATCTAAATCTCATCTTTCATATTTTTTTTCCCTACAGGCTGTTATGATGGA
TTAGTTTATGTTCTAAAAAGTAATACTGGAGAAAACTACTGGAGGTTTATTACTGAAGAT
GCTGTCAAAAGCTCGGCCACAGTGGATCCAACCACAGGACTCCTGTACATTGGCTCTCAT
GACCAGCATGCATACGCTTTAGATATTTATGTAAGAATTCACCTCATCCATCTAACACAG
CAGTTCTCAACCTATGGGTCGCAGCGTTAGGAAGGTTGAGAACCACTGGTCTAACACCAT
CAGCATAGAAGAGCAAGAAACTGCCAGGTGCTGTGGAGCCTGGGAACAGGTGCTGTTTCC
CACACTTGGCACTGTGATCTGGGAAGAATAAAGCATTAGTTAAGTCTTCATATCTCAGGA
CATTTTGAACTTCTTTACTCAATTTACCACAAATAAGTTTTCTGTTCAGGGTTTTGAAAT
GTAAAGAACTTAGAATTGGCTCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCCACGT
ACACCTAAGGTGGCGGGTTCGAATCCCCAGCCCGGACCTGCCAAACAACAATGACGGCTG
CAACCAAAAATAGCCGGGCATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAATGTAAAGAACTTAGAATTAACATCTTGACAATTGAAGAAGATCATAAAGGAGGGT
ATCAGCTGTTTTAAGACCTCATTACATAAGAGCCAAAAAAATTTCTATTAAGAATTAACA
AAATTTAAAGAAGCACACTGAGAAAACATTGTCAAGAAAAGTGAAAGTGGGCGGCACCTG
TGGCTCAAAGAAGTAAGGTGCCAGCCCCATATACCAGAGGTGGCGGGCTCAAACCCAGCC
CTGGCCAAAAAAAAAAAAATAAAAGTGAAAGAGTTAAAATTCATTTATATTTATTATAAA
TGAAAATAAAAAGCAAATACAAATTAATAACAAAGATATAAAGATCCCAATAGGAAAATA
AATAAGGAACATAAACACACAGGACCTCCAAAAAGAAATGGCTAGAAAATGTGTAGAAAT
ATTTTGCACCTTTAATATTTAAGATGCCAATTTATAACTATCAGATGGGAACACAAATGA
TATTAGAATAGAAAGGATACTAATTACAGTGACAGTAAATGAGTAAATGCTGATAATAGT
GGTTTGAAGTTGTAACTGGTAAAGCTTCTAAGGAAAACAATTTGACTATATGTAGCGAGT
TCATATCCTTCAATCCAGTAAAATTGTTTTTCTAAGAATCTATGTTGGCAAAATAATTAG
ACACATGGACAAATATTTGCACCAAGATGTCTATTTCTAAGAACTTAGTTACAAAAAAAT
TTTCAGTGATAAAGATAAATTATTTTATGTTCATGTGGGATATTATGCATCAAAATTGGA
ATAGTTTTACACAGTAAGTGAGCAAAACATGATTACCAAATTGTATATTCAGCACGATCT
CGTGTATATGTGCACACATACACCAACCGCAAGCAAAACCAAAATAATTTGCTTTCTTAT
TTTCAGAAAAAGAAGTGTGTTTGGAAGTTAAAATGTGGGGGAACTGTCTTTTCTTCTCCT
TGTTTGAGCCTGAACCCACATCATCTATATTGTGCTACACTGGGAGGACTTTTACTGGCT
GTAAATCCTGTAGGTGTAGAATGTGTTCATCGTATTATCTTATTTTTTTTTATTTTTTGT
TTTAAATTTTGCTTTGAATTCTGAAAGTTGGAGTAGTTTTCAGTTAATTATATATAGTCC
ACATATTACTGAACTAGAATTCTTTTTTTTTTTAACTGAACTAGAATTCATTAAAAATGA
TTGCTATAAAACATAGAAAGATGACAAAATCTGAGTTCCTGAGTATATATTTCATCTATA
TTCTAAATTGGCAGAATTTTTTCATATTAAGATCTTCGTGTTCATCATAAGGATAGATCT
TGGGTACTAGTTATTTCTTTCCTGGTTTACTGCAGGTTTTTCTCCTAGCTTTCATAAATA
GCACTGATTAATTTTATAGCTGCATATATGAGGTCTGACAGTCAACTTCATGAACTCATC
CTGGAAAAAGCACTATACACCTCACTGCTGAACGTCACTACTGTCACCTTTGAAGTACTT
CCCTCGGGAAGCTATGCACCAATGCCAGTGCCTAGTCCACCTTTCAAAGCAATTTTGGAA
CTTTTTTTCTAGAATGACCATCAGAGCTATTGTTGTAGAAGGTCTGCAGTTAAGTTCACA
AACTTGCCACTGAGTTCTTATGTTGACAGCACTGTACAAACAACTCAGTAAGGTTTTATA
ACCTTGGCATATCAGGGTCTCACAGCTGTGTTCTTGTCAGTGCGTGGTGGTATCTTGCTG
AGTGGCATTCATTATTGTTGTGTCTTTTTGTGTGCCCTATGGTGATAGCTCTGATGGTCA
TTCCAGAATTGCTTTGAAGGGTGGACTTGGTGCTAGCAATGGTGCATAGCTTCCCAAGGG
AAGTTCTTTGAAGGTGACTGTAGTAATATTCAGCAAAGAGGTATGTAGTACTTTTTCTAG
GATGAGTTCATGAACTCATGTGTGTATTAACTAGCTTCATTTATGTCAGTATTTTCTGAT
ATTTTAGTTCTGCCTCAGAGAAACTTAGGATTTGTTTTATAAAGGATAATCAATTACTGG
AAAGATTTCAAATGCTGTGAATTTCTTTTTGCCCATGACAGGCTACTGGGAACATAATTT
GGAAACATTCCTGTGGAAAGCCACTCTTCTCTTCTCCGCAGTGTTGCTTACAATATATTT
GCATTGGCTGTGTTGATGGGAATTTACTCTGCTTTACTCACTTGGGAGAACAGGTAAAAA
TTTCTAGTTCTATTATACATCTTTGTCAAAGGCATAGTAGATGATGACAATTGAAGTAAA
ATTTTAAATATTATATTTATTTTTTTGAGACAGAGTCACACTTTGTTGCCCTGGGTAGAG
TGCTGTGGCATGATAGCTCACAGCAACCTCCAACTCAGTTTTGCTAGCACCATTTACTGA
ACAGTGTGTCCTTTCCCCAATATGTGCTTTTGGCACCTTTGTCAAAAATCAGCTGTAAAT
ATGTGAGTTTATTTCTAGGTTCTCTATACTTTTCCATTGGTCTGTGTGTCTGCGTTTATA
CCAACACCATACTGTTTTGGTTACTATAGCTTTGTGGGGTGTGTGTATGTGTGTATGTGT
ATGTGTGTGTGTGTATATATATTTTTTTTTTTTTTTTTTTGAGACAGAGTTTCACTTTTT
CACCCTTGGTAGAGTGCCATGGTGTAATACCTCACAGCAACCTGAGACTTTGGGCTGAAG
TGATTCTCTTGCCTCAGCCTTCCAAGTAGCTAGGACTACAGATGCCCACCGCAACGCTCG
GCTATTTTTAGAGACAGGGTCTCACTCTAGCTTAGGCTGTGAGCTCAAGCAATCCACCAC
CTCAGCCTCCCAGAGTGCTGGGATTACAGGCGTGAGCCAGCTTTGAGGTATATTTTGATA
TCCCATAGTGATGTCCAGCTTCATTTTTTTTTTTTTTTTGGCTTAGAATTTCTTTGGCTC
TTTGAATTCTTTTTTGGTATGAATTTTGAATGAATGTGAATTTCTATTTCTGTGAAAAAT
AACTTTGGTGTTTTGATAGGGATTGCATTGAATCTGCAGATTGCTTTGGTAATATGGTCA
TTTTAACACTGTTAATTCCTTTAAAACACAAGCATGGAGTGCCTTCCACTTGTTTGTGTC
CTCTTCAACTTCTTTTATCAGCAGTGTTCAGTAGTTTATAGTTTTCTTGGTAGAGGTCTT
TCACCTCTTTAGCTAAATTTATTCCTAGAGTTATCGTGTTTCCTTTTGTGTGGTTGGAGG
TTTGTTTTATTTTTGTTTTTGTATCTGCTAGTTGCCTTTTTTGATTTCTTTCTCAGCCAG
GTCCTCATTGTTGTATAGAAATGCTACTAATTTTTGTATGTTGGTTTTGTGTCTTGCAAC
TTTGCATATATTTATCGTATCTAAGAATTTCTTGGTTTTTCTAGATATAAGATCATGTCA
TCTGCAAAGAAGGATGATTTGACTTTCTTGATTCCTTTTATTTCTTTCTCTTGCCAGATT
GCTCTGGCTGGAACATCCAGTCCTATGTTGAACAGCAGTAGTGAAAGTAGGCATCCCCGT
CTCGTTCCACTTCTTAGAGGAAAGACTTAGCTTTTCCCTGTTCAGTTTGATTTACGTCAT
ATAAATCCTTATGTCATATCCTGCCTTATGTGAGATATGTTCTTTCAGTGCCTAGATTGT
GGAGAGTTTTTATCATGAAAAATTATGGTAAGACATATGATTAAAAAACTGAGATGGGAG
AGTCACTTGAGGTTAGGAGTTTGAGACAAGCCTGGCCAACATAGTGAGACCCTATCTTTA
CAGAAATTCTAAAAATTAACCAGGCGTGGTAGTGCCTATAGTCCTAGCTGCTTGGGATGT
TGAGGCAGGAGGATCACTTGAGCCTAGGAGTTTGATGTTGCAGTGAGATATAATTGTGCC
ACTGTACTCTAGCCTGTATGGGAGAATGAGACCCTGTCTCTAAAATAATTTATTTATTTT
TTTTTGAGACAGAGTCTCACTATGTTGCCCTGGGTAGAGTACCTTGGTGTCACAGCTCAC
AATAACCTCAAACTCTTGGGCTTAAGCTATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGG
ACTACAGGTGCCGCCACAACGCCCAGCTATTTTGTTGTTGTTGTTGTAGTTGTCATAGTT
GTTTGGCAGGCCTGGGCTGGGTTTGAACCCACCACCCCTTGTGTATGTGGCCAGTGCCCT
AGCTGCTGAGCTACAGGTGCCAAGTCAGAATTTCTTTTAAATATGATTTTTTTCCTTCAT
TTCGTTAATGTGATTAATCACTTTCACTGCTTTATGTTGAGCCATCCTTGCATCCCTGGG
ATAAATCCCACTAAATCATGGTGTTTTAGGCACTTGAATTTTGTTTGCTGTTATTTTGTT
GAGGATTTTTGCATCTGTGTTCATTGGGGGTATTGGCCTGTAGTTTTCTTTTTTGTTGCA
TCCTTGTCTGGTTTTGGTATCAGGCTCATGCTGACCTCATAGACTGAGTTAGGGAAAAAT
CTCTCCTTTTCAATTTTTTGGAGTAGTTTGAGGAGAATTAGCCTTGGTTCTTCTTTGAAC
GTTTGGTGGACTTCAGCAGTAAAGCCCTCCCATCCCCTCTGTCTTTGGGTGGAAGATTTT
TATTACGGATTCAATCTCATTAATTCATTACCTGTTCAGGTTTTCTGCTTTTTCCTGATT
CCGTGTTGGTAGGTTGCATGTGTCCCAGAATTTATCCATTTCCTCCAGACTTCCCAGTTT
ATTTGTGTAGTTGTTCATGATCATGTATGTCCTATCATGTAGAATGCCCCCTTTTTCATT
TCTGATTTTATTTACGTCTGTCTTTCTTCCTTAGATATCTAGTTAGCATCTTACCCTTTA
CCTACACAAATAAACAGCTTTTGTTTCCTTGATCCTTTGTATAGGTTTTCTTGTCTCTTG
TTTTGTTCTCTGATCTTCATTAGAGAATAGAGTGAGATAGTTTTTAATGAGATATGTGGA
AAACTCAATGCAGTTTTTTGTCTTTGAGCTCATTGTCTCTGAACATGCTAGTAATAACTC
TCAAATGGGGTTCAAGATTAGTTTTACTCATGTTATGCCTAGCAGTGAATCAGGCGACAA
TAATATGCCAGTGTATTCTGTCTTTGGATTTTGCCACTGGGACAGAGGTCTAGTATGAGG
CACTACTTACTTTTCAGGAAAAGCCATTTTCTGTGTGTGTAGTTACATTTCAAATAGTCT
CCGTATCTTAGCTTTGTATTATGAAGCTCATGGTGCATTACGGGAGGACTGCTGCAATTA
GATGACTGAGTGATATTTTTATTTTATTACTCTTTATAGGTTTGGCAGTTCTTTACCAGT
GGACCGATCTTTTCATCCCCATGTATCTCAGCATCAGAGCAAGACATATTTTTTGGTTCC
CATGATTGCTTTATCTACTGTTGTAACAGGAAAGGTCACCTCCGATGGAAATTTGAAACT
ACTTCACGGGTATATGCAACACCGTTTGCTTTCCATAACCAAGATCACAGCACTGAAATG
TTGCTGGCAGCAGCATCTACGGATGGGAAACTGTGGATCTTGGATTCTCAGAGTGGACAA
CTGAGAAGTGTGTATGAACTTCCCGGAGAGGTCTTCTCTTCTCCTGTAGTCTGGGAATCA
ATGCTCATTATTGGATGTAGAAATAATTATATTTATTGTCTGGATTTATTGGGTGGCAAT
AAAAAATAATCAGGTACAATCCTTATTAGCATATATCTGTGAGATGTTTGAAAATATTTT
ACCATAGGCCAGGTACAGTGGCTTAGCCTATAATCCTAGCACTCCGGGAGGCCGAGGCAG
GTGGATAGCTTGAGCTCATGAGTTCGAGACCAGCTTGATCAAAAGCAAGACTTCCCCCCC
CCCATCTCTACTAAAAAAGTAGAAAAACTGGGACAAGAGGATTGCTTGAGCCCAAGAGTT
GGAGGTTGCTGTGAGCTATGATGCTGCGGCACTCTACCCAGGGCAATAGCTTGAGACTCT
GGCTCAAGAAAAAAAAAAAAGAAAATATTTTACCATTATAGAGCAGGTAGATGGTCTTAT
TCTACATTAAAGATTATTCTTTGATTAAGAAACTGAAACTTGTCTATACCTTATTGGAGA
ACAACCATATTTTACTTCCTGTAAGAAGAACAAAAACATTTAGGAGTTAGAGAACAAAAC
AGATCAATTACTATTTGGTAGCATTTTCTTTAATTAGATGTGATTATTGATTTTATGTTG
TCAGCTTGACTGGGGTAAGGGATGCCCAGATAGCTGGCAAAACATTAGGTATATCACACA
GTAGAACCTCTGTAAGTTGACCACTCAAGGGACTGTTAACAAACTGGTCAGCTTATGGAG
GTGGTGAATATGAGGAACTAGGCCTACTGTACAGATGGATACATGTGGTGCATGTCCAGT
CTGTGAAAATTAGGTCAACTTTAGAGGTTCTACTGTGTGTGTTAACAAAAGATGAATACA
AGTCCCGTTGAGCACCTCTTGTAATGGCAGAACTCAAAATGTGACTTGAGTATTACAAAT
TTAATGCACTTTTTTCCTTTCTTAAAATATGTATACATTTTTTGGCACCCTGAGTGTGTG
TATGTGTAAAAGCTCTTCTTTATGTTTCTCTGGAGAACCCTGGGTAATATAGGCTAATTT
TATGTTAATTTCATTCACGTATGCATTGATTCATTTATTTTTAAAGACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1230, 2474..2594, 5546..5862, 9494..9686, 12336..12577, 12948..13054, 13865..14037, 14705..14897, 18162..18277, 19523..20312, 21406..21569, 22986..23108, 24161..24292, 27399..27788
1001..1230, 2474..2594, 5546..5862, 9494..9686, 12336..12577, 12948..13054, 13865..14037, 14705..14897, 18162..18277, 19523..20312, 21406..21569, 22986..23108, 24161..24292, 27399..27785
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved