Otolemur_garnettii Locus YIPF1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii YIPF1
Otolemur_garnettii
YIPF1
GeneScaffold_283
SNORA16
34263..34396
36883
AGTGACTGAGGAAGAACAACCTCTCTAAAAACAAAAAAACCATAAAACCCCGAGGCTCA
CCCTCCGGAGGGCGAAGGAGGGACCACTCTGGGCGCCGCAGCCCGCAGAGGTCCCTGGGA
GGGCTCCGGGAGCTGCTGTCTCTTTAAGAAGGCGGGTCTCATCCCGGAGGAGGTGGGATA
AGTCCCGCCTCCCGGACCTCCGGCTTCCGGCAACTTGGCTGGACCAGAACCGGAGCAGAA
CTTCTAAGGCTGGATCCTTCCCGAGACCGGCTGGACGCCGAGCCCCGCGAGGTGAGGCGG
CCAGGTTTTGCGGGATCAGTCTGGGACTGAGAGAGCTTGGTATCTCCTGCCCTCCCGGGC
CGCTGCGGCCCAGCTCCTCTCCCTACAACACTGCCCCTGCTGCTCTGCGTCCCAGGCTGC
GGGGTCGCTAACACTCCAGCGCCCACTAATTGCTGGCTCTGCGCTAAGCATCTAACGCGC
ACTGTCTCATTTCATGGACCGCACACTGTGTGAGTAGGTACCATTATGAACCCATTTTGC
AGATGAGGAATCTGAGGCCCCGAGGAGCGTACACACACCAGAGAAGCGGCAGAATCGGGA
GAATCCAGTCGTTCTGATCCAGAGCTGTGCCCTACACTGCTAGCAGAGCTGCCTTTGTTC
TTCACTGTCTCCCATCACTCTCTCCTCCTCATCCTTGTATCTGCAGGTTACACCTGGTCG
CTGCCAAATCACACAGTGAGAGAGATTGGAACCTTTGGACCCCTGGAGTTAGTTTCTTAT
GACAGTTTTAGTAATACCTGATGCTTAGCGATTATCTTTATATAAACTTACCAAACCCCA
CTGAAAAAGGAGGCAAGGAGAAGCTGTACCATTTTTAACGATGAAATAAACTTTGTTTGT
GGATGTTTTATTCTGTTATCCTATTATGCTCTTACTTATTTTTTCCTTTTAGACCCCTGC
AAATTTTCTTCCTCATAATTGGGAGAAGACCCACTGGCTGAATGGCAGCTGTAGATGACT
TGCAGTTTGAAGGTACATTAGTTGGGTGCCCACCTTTATCTTCATGACACTGTCTCCACA
GTCACAGCAATGCATTTTCTTTGCTGTACTGCTTCCCACATTAAGAATATTATAGTCTGG
GTACGATGGCTCATGCCTGTAATCCTGCACTCTGAGGGCCCAAGGCGGGTAAGTTGCCTG
AGCTCAGGAGTTCGAGACCTTGTCTTTAAAAAGAGCTGGGTGGTGTGGCGGGTGTCTGTA
GTCCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAGCCCAAGAGTTTGAAGTTG
CTGTGAGCTATGATGCGACAGCACTCCACCAAGAGCAAGAAAGTGAGACTCTGTCTCACA
ATAAGAGAAAAGAGATATTATTTCAAACATCTTGGCGAAAGACTGGCCCACCTAGATTTT
CTCTGTCCTCATTAGCTGTTCTTTTTTTTTTCCTTCTTTTTTGCCAAATAGCCCTTCAGA
TTGGTTAACAGGTATATAAATTTAGTGCAGTGATTACAGAAAATGTTTATACAGTTTCTG
CTTTAGTTTAGCAAACATTTATTGAGTACCTACTTTATGCTTAGAACTGTACTGGATACT
AGGGATAAAAAGATAAAGGTTTTACACGCTGGTAGATTAAAGTGTAGAAAGATAATTAGG
AGGAAATGTGATCAGTTCAGTCTTTCATTGAATCAGTAGATATTTCATGAGGTGATCAGG
AACCAGGCATTGTTCTATTAGGGATAAAAGAGTGAAGGAAGCTGTTTGCTCGCTTTTTTT
TTTTTTTTTTGAGATAGAGCTGTGTTGCCCCAGACTAGAGTGTCCCAATGTCATAGCTCA
CAGCAACCTCAGACTACTGGGTTTAAGTGATCCTCTTGCTTCAGCTTCCCGAGTAGCTGG
GACTATAGGCAAGCACCACTGTGCCTGGCTAATTTTTCCATTTTTAGTAGAATGGGGTCT
CACTCTTGCTCAGACTGGTCTTGAACTCCTGAGTTCAAGCAATCCTGCCTCAGCCTCCAA
TAGTACTGACATTGTAGGCATAGACTATTGTGCCTGGCTTTTTCTTTTTGGAGACAGAGC
CTCAAGCTGTCCCCCTGGGTAGAGTGCTATGGCATCACAGCTCACAGCAACCTCCAACTC
CTGGGCTCAAGTGAGTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACCACAGGTGCCCGC
CACAATGCCTGGCTATTTTTTGGTTGCAGCCGTCATTGTTGTCTGGTGGGCTGGGCTGGA
TTATTACCACCCACCATATTAGTATGACGCTGATAGCGTCAGTAACTTGAGCAACTATAG
CGATGATGCGCCTGGATTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTGCCTCAAGCCTTCCCAAGGTAACTAGAATTTACAGGCACTTGCCACAATGCC
TGGCTACTTTTAGAGATGGGGTCTCGACCTGGCTCAGACTGGTATTGAACTCGTGAGCTC
AGGCTCTCAGAATGCTAGGATTCCAAGGCATGAGCCACACACCTGGCCTCTTATGCTCTC
TAATATCTGAGGAAGAGATAAGATGTTTGAGGAGAAATCCACTTCATTGGCAAATACTGT
CAGTTCCATCTTCAAAATTCATCTGGTGTCTGACTACCTCTCACTACCTTCACCACTCTT
CCCACCATGTTCAAGGTTACCATCACCTTTTGTCTGAAATAGCCCTTACTCTCCTTCTAG
TCTTCCTGCTTCCTTCCTTACCCCCTACAGTCTGTACTTTGCACCCAGAGTAGGTCTTTT
AAAACTAAGTCAGATCATATTACTCTTTTAACACCTTCTGGCAGCTCCTGTCACACTGGG
AGTGAAAGCCAGAACCCTTTTCTATGGCTTGGGGGGCCCCCACATGATCTAGCTTTCTGT
TGCCTTTGATTTCATCTCCAGCTGCTCTTGTCCTTTCTCTGCTCCAGCCACACAAGCCTG
TCACTGTTCTCCTGTGTCCCAAGTGCACTCAGCTTGGGGCTTTTGTGTCATCTTTCTGTT
GGGGGCATTCCTCCTTCATATAGCCACATGGCTTGCTCCCTTGGTTGGTTCACATCTCAC
CTGGTTAGAGAGGCCTGACTTGGCCATCCCATCTAGGAGTACAGAGTGTGAAAGTTAAAG
CTTGGTGAGCAGCTGTTCAAAGTGCCTGTTGAGGGAGGAAGTTTGCTGAATTTTTTCCCA
AAGAATTGAAAGAAAGCCTATATTTCAGATCACAGGTGGTGCGTGAGGCTAAAACAAAGT
GAAGATTGAGTTGAGGCAGGTGACAAATCATTCAGGGATTTATAAACTATGATTAGGACT
TCAATCTTTAGAAAAGAACATAGGATGCTGTGGGGGTCATGATGAAGGATGGTAGTGTTG
GCTCAGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCCACGTACACCTAAGGTGGCGGGT
TCGAATCCCCAGCCCGGACCCGCCAAACAACAATGATGGCTGCAACCAAAAAATAGCCGG
GCGTTGTGGTGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTT
GAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGCCACGGCACTCTGTCCAGGGGGAC
AGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAGGATGGTAGTGTTAGATGGAAAAGGGG
AGCTCTAGAAATGCAAATCAAAACCACTTTGAGATATCATCTAACTCCAGTCAGATTAGG
CCACATCACAAAATCCCCAAACTACAGATAATGGTGTGGATGCAGAGAGAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAATC
TGAATTTTAAAAGCTGATCCTTGTTTTAATGCTTGCTTTTATATCAGGCTAAGAGTTGAG
CATTGACTGTTTCAGATTTAGTTAATAAGTGCAGAAGAGGCCAGGCTTGGTGGCTGACAC
CTGTAATCCTAACACTCTGGGAGGCCGAAGCGGGTGGATTGCCTGAGCTCAGAGTTCAAG
ATGAGCCTGAGCAAGAGTGAGACCCTGTCTCCACTAAAAATAGAAAAAACTAGCCAGGTG
TGGTGGCAGGCGCCTGCAGTCCCAGCTACTCAGGAGGCTGAGGTAAGGGGATCGCTTAGC
CCAAGAGTTTGAGGTTGCTGTGAGCTATGATGCCAGGGCACTCTACCCAGAGCAGCAGAG
TGAGACTCTGTCTCAGAAAAAAAAATAATGCAGAAGAGCCTGGTGTTTTGAACATTTGGT
TTTCTGGTAGGTCAGCCCGTGCCGTCTCTCTCTCCTCTCCTCTCTCTGCAGCTGGAATTA
GAAAATTGCTTCTGTGTTCATTGTTTTGTTTTACCTCCGACAGTTACTTGCTGGACAGAA
GAAGAGCTCCCCCTTCTGGACATTTGAATACTATCAAACATTCTTTGATGTGGACACGTA
CCAGGTCTGTAAACCAGTTTTCCCTGTGCTCTCACGTGTAATGGAGACTTGTTTCCTCTG
TGTGAAAGCCTTTGTATACTAGAAATGTTCTTATACAAGTAAAGGGTTATTAGTGTTTGA
AAATACTATCACAAAAGCTCTAATGACTGAATTTTAACTTTGTAGAAATCGGGTTTATTA
AACTGTTGAAGAAAATCTCCAGTAGAATCACTGCTGTGTTGTTTTGCAGGTCTTTGACAG
AATTAAAGGGTCACTTTTGCCTATACCTGGAAAAAACTTTGTGAGATTATATATCCGCAG
CAATCCAGATCTCTATGGTATGTGTAGTGCTGATTTGATTATTTACCATATTCCATATGA
ACTTGGGTGAGTGTGAGTGTTGCCTAGAAAGCTGGAGGATTACACTGTTAGTGGGGTGTG
CGACATTTTTTTTTCCCGAGTAGCTACCTTTGCAAAGAATTTTTGGGAAGGTGCAATTAT
GTGTTGTATTCACGCCATAATTACAGGTACTAGCATGTCCTTTACAAGTCTTCAAATGGC
ATTACAAACTTGAGACAAATTAAGTCACTTTGACTAAGAGGAGATTGTTAGTTCTAACTT
CTCGAGGATTTGCTGGTGGTGGAGAAGGTTTCCTCTCACTTTTTTTGTTTATGTGCTGAG
TTCCAGCTCTGCCTTCAGATGAGCTGCCCTGGATGTGGTCACCAGCCCTGGCAGTCTGAA
GCCAAATTAGGCTGGGGATGGCTGTCATCCCTGGCATCTGTGCTGTTCGAGAAAAACTCA
GAGGTCCATCCAGTGCTCCTGAAGAAAGGTCCCCCCCAGCAGTGGCCTGTGTTAAGGGGA
AAGAGGGTGCTGTCAGTGTGCCAGGTGCTGTGTGTCCTTGGTCCTACAACAGCCCCTTGC
AAATGGTCCCCCACTTTTCAAATGAGGAAGCTGATGTTCACTGAGGTTCCCTGATATGTA
TATATGCTTAACCCCAAATGATAAATAATAAAGCAATTATATATGTTGATTTGGAATATG
GGCTTTGTGGAATTCCTAGAATTCCAGGGAGCCTGACGTGAAACCTTTGAATTAGCATGA
GCATCTTACCTGTAAGTTGTAAAGGTAGATCCGCCTTATAGCAATTTCGCTCAATCAGGA
GATAAACGGTAGACCTGGTTGAAGAAAAGTCTTGGTATATATATTCTAGCTCTCGAGCTG
GTTAATTAGTATCTTAAAACCTCCCCTGCCATTTTTTTTTTTATTATTTTTGTCCTTTTT
TCTTTTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGGATCAGCAGT
GCAAAGGTCCTGAGGCAGGGCCTGGCATAGTATGTTCAAAGACACTAGTGTACTGGTGAG
AACGAACGAGGGGGCCTTGTAGATGATGAGTCCCAGAGACAGGCTGGAGGGGCAGGTGAC
ACAAGGTCTCGTAAGTCATATGGAGACTTTGGCTTTTACTTGAGTGAGAAGCCGTTGGAA
GGCTTGAGGAGAGGAATGACGGATTTTAAGTCCAATTTCACAAACACTGATATTAAGTGT
TGGCAAGGATTGGTGCAGTGGGAACCTTTGTATAATGCTGGTGGCTACGTAACTGGGACA
TAAATTGGAGCAGATTGAGCATTTTCACTCCTAGATGTGTGATTTAGAGAAACTCACATC
TGTACAAGATGACATACAGAAGAATATTTTTCCTGCAGCATTGCTTGTAATAGAAAATAT
TTAGAAAGAACCAAAATACCTATCAGCAAGAGAATGGATAAATAGTGGCATATTCATATG
TGGAATCCTGTAGTTTTTAAGAAATGAGTAAATGGATAAATCTCAGAACAATGCTAAATG
AAAAAAAAATGTAGAAGGATGTGAATAGTAAGACACAAAAGTTGAGAAAGACTCTGAGAC
CAGGCACAGTGCTCATGCCTGTAATCTCCGAGCTTTGAGAGGACAAGGCAGAAGGAACAC
TTGAGGCCAGGAGTTTGAGACTAGCCTGGGCAACATAGCCAGACCCCATGTCTACAAAAA
ATGAAAACATTAGCCCAGTGTGGTAGCACATGCTTGTAGTCTCAGCTACTTGAGAGGCTA
AGGCATGAGGCTCACTTGCGCCTAGGAGTTTGGGGCTGCAGTGAGCTACTGATCACAGCA
CTGTACTCCAGCCTGGGCAACAGAGTGAGACCTTGTCTTCAAGGGAAAAAAAAATTTAAG
TGGCAAGATAAGTATACTAGTGTTGTTTAAATTCTTCATTTTGCCTTTCTATATGTGAGA
AATATTTCATAATGTAAAGATGTATAGTGTGAAATTTTACGTATAAACACAAACTCAATT
CAGGCTCCCTCCCACCCTCCTCCCTATAATGAGAGTAGGGACTTAGCAGGAAAGGGGAGA
AGGCAGTATGAAGTAGCACAGCAGACCCTGGGTCAGGGGTGTCCAGTGTCTCTGGAGTCC
AAGCTTCCTGTGGGGGCAGCTGGAGAGGTTACAGAGCCCAGATCCTGGTGAGCCTTGTGT
ATCAGCCTGAGGAATCTGAACTTTGTCCTTCAGCAGTGAGGGTTCATTGAAGGGTTGCGA
AAAGGGACAAGAGTGCTAAGTGCAAGTGCTGGGAAAGTTTTCTTCTGCTTTATTGATGTT
GGGCCAGAGAAGGGTAGTGGGTGGGCAGGTGCTGGTATTTCAGACTATCCAAAAACATTG
TTCCTCTGCTGGGGCTTTTAGGTAGCTTAGGGCAAGGGGCAGCCAGTAGTGGTTACATCA
GTATAAATATCTCCCCATATCAGAACTTTTTTTTTTTTATGAGGAAGGGTCTCTTTCTGT
TGCCCAGGCTGGAATGCAGTGACACAGTCATAGCTCACTGTGGCCTCCTGGGCTCCAGCA
ATTCTCCTGCCACAGGCCACCTGTCCCCCAATTAGTTAAGACTACAGGTACAGGCTCGGC
GCCTGTGGCTCAAGCGGCTAAGGCGCCAGCCACATACACCTAAGGTGGCGGATTTGAATC
CCCAGCCCGGGCCCGCCAAACAACAATGATGGCTGCAACCAAAAAATGGCCAGGCGTTGT
GGTGGGCGCCTATAGTCCCGGCTGCTTGGGAGGCTGAGGCAGGAGACTCGCTTGAGCCCA
GGAGTTGGAGGTTGCTGTGAGCATGATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGATAATGACTAATAGGTTC
TGATATTCTTGGCCTTCTAGTGTATAAAGGTATTAAAAATTAATATTTTGGCTCAGCGCC
TGTGGCTCAAGCAGCTAAGGTGCCAGCCACATACACCTAAGGTGGCGAGTTCGAATCCCC
AACCTGGGCCCGCCAAACAACAATGATGGCTGCAGCCAAAAAATGGCCAGGCGTTGTGGC
GGGTGCCTATAGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTTGAGCCCAGGA
GTTGGAGTTTGCTGTGAGCGTGATGCCATGGCACTCTACCCAGGGGGACAGCTTGAGGTT
CCGTCTCAAAAAAAAAAAAAATTAATATTTTGGCTACTTGTGGTTATCTGCTTGGATGGT
CTCAGCCCATCTACAACACATAGTCAGTTTTGTTCATTCATTCCGTAAAGCTCTGTGGTT
GTGGAGGTTTATTGTTTGATTGTTTGTATCTCTCATGTGGTGGGCGCTTAGGGTCTGTAG
AGAGATTTCATCCTTGGCTGCAGCAGACGATTTGTGGAAAGCTAATGTTGGCGACTCTTT
GGAGCATCCCAGTTGATGGCTGGTGTTTCCTTTCCAGTGCTTGGCTTTGAAAAGTACTCA
GCTATTTCTCCTAGTCATCCCACCTAGTACAATAAATAATTTTCTTAATTTTGTGATAGT
TAAAGGTACCTGAACTTATCCCAAAGTGTGTTGTAAAATATTCGTGAAATTGAAACCGTT
AAAATCTCTCTATTTAGAACTTGCGTTTGTTCTACCCAGGACTTTCCTTAGGTGAGGAGA
GAAAAGATGGCGTTGGTGAGATCAAGCAGATGATGAAAGGAGTTGGCAAAGTCTGGTGCA
CTCATCCACTCGGGGAGTATTTTAATAACCGTTAAAAAAGACTAGGCTGGGCGGTGTCTG
GCTCACGCCAGCCCCATGTACCAGAGATGGTGGGTTCAAACGCAGCCCTGGGCAAAAAAC
TGCAAAAAAAAAAAAAAAGACTAGGCAGATTTTTATGAATAGCTATGGCAGAGTCTCTAG
ACTATAATAAGGTGAAAACGGAGCGTACCCCGCAGGGCGTGCGTGCGTGCTGTCATCTGT
GTGAAGCGTGCACAGGCAGGCACACAGACGTATTTGCTTATGTGTGGATAGAATGTTTCT
GGTGGGATTCACCAGGAACTGGTTACAGAGGTGTTTGTGGAAAACGTTCAAGCCTGCTTT
TCCTATCATGTCACACCAGTGTGCTAATCAACACAGAACACTCCCGCGACCGGTGTGTGT
CGGGGGGAATACCCGCCAACAAGCAGTGGGCAGCAGCCGGTGTGCTCCAGCTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGAAAGACACTATTATTTAAGTT
GTGATGGCTCAACTAGCTAGGACAGCCTGTGATATGAAGTCCTGGAGGGGAAAATACAGA
CAGGAATGTGTCCTAGTAAGGGGCTGGCAGATGACGTGCTTATTTTAAAACTTCCTTTCT
TGTGTCAGTATTGGGTAGTTTAAAAAAAAAACACAAAACAGCTTTTAGGGACTTGCAGAT
GACAGCGCCCCAGACGAGGAAGTATGGCCCAGGGGGAGATTGACCTGTGCATGTTCTCAA
CTCCCTGCCCCCCTTCCCTGCCCACTCTTACTCTGGGAGGCTGTAAGCAGCCTGGTTAAG
GAGACAGGTTCTGGAACCAGACCACTGGCTTCAGGTTCCAGCCCCACCACTCTCTAGATT
CTACCGTGTTGGGCTGTTTCATCCCTCTTGGTCCATTGTTCATTGGTAAAATGGAAATAG
TAATAGTGACATCACAGGGCTACTTTAAGAATAAAGAGTTGATACATGTAAAGAGGTTAA
AATAGTGGTTTGTATAAAAAGTTTAGTAAATACTAACTAGTGCTGTGTTACATATAGGGA
GATGTGTGTTTCCTGTGTGACGGCACCTGAGGGTCCGCGTGTCCATATAGGGAGATGTGT
ATTTGCCTGTGTGAGAGCACCTGAGGGTCCACGTGTCCATATAGGGAGATGTGTATTTCC
TGTGTGACAGCACCTGAGGGTCCATGTGTCCATATAGGGAGATGTGTATTTCCTGTGTGA
CGGCACCTGAGGGTCCATGTGTCCATATAGGGAGATGTGTATTTCCTGTGTGACGGCACC
TGAGGGTCCACGTGTCCATATAGGGAGATGTGTATTTCCTATGTGTCGGCACCTGAGGGT
CCACGTGTCCATATAGGGAGATGTGTATTTCCTATGTGTCGGCACCTGAGGGTCCACGTG
TCCATATAGGGAGATGTGTATTTCCTGTGTGACAGCACCTGAGGGTCCACGTGTCCATAT
AGGGAGAAGTGTATTTCCTATGTGTCGGCACCTGAGGGTCCACGTGTCCATATAGGGAGA
TGTGTATTTCCTGTGTGACAGCACCTGAGGGTCCATGTGTCCATATAGGGAGATGTGTAT
TTCCTATGTGTCGGCACCTGAGGGTCCACATGTCCATATAGGGAGATGTGTATTTTCTGT
GTGACGGCACCTGAGGGTCCATGTGTCCATATAGGGAGATGTGTATTTCCTATGTGTCGG
CACCTGAGGGTCCACATGTCCATATAGGGAGATGTGTATTTCCTGTGTGACGGCACCTGA
GGAGCCACGTGTCCCTATAGAGAGATGTGTAATTTCCTGTGTGAGAGCACCTGAGGGCCA
CGTGTCCATATAGGGAGATGTGTATTTCCTGTGTAGACGGCACCTGAGGGTCCACGTGTA
CTATATAAGAAGATGTGTATTTGCCCTGTGTGAGAGCACATGAGGACTCACGTGCCCATA
ATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGACCCACCTTGCCTAGGGATCTGGAAGCTCTTCTCTGAGCTTTATCTGTTCCC
ATCCTCTTTAGCTGGGCATCCCAGTGTCAGGGAGTGATGTGATGTAGGTACCAGTAAGAT
AATCACTGGCCCTATCAATAAACACGTTTCCATTTCATTTGAAGGGCATGAGTCACATCA
GGCATCAGATCCTGCTCCCACCCACTTGTTAATTATGTTACTTTGACCAAATAACTTAGT
TTCTCTGATCCATTTCCTCATCTCTGAAATGAAGACAGGCTGATTGTGGTGGTTCATGCA
TGTAATCCCAGTGCATTGGGAGGTCAAGGTAGAAGGATGGCATGAGGCAAGGAGTTCAAG
ACGAGCCTGGGCAACATAGCAAGACTCCAGCTCTCCGTACCCATAGTTTATAGTCCTAGC
TACTTGGGAGGTTGAGGCAGGATTGCTTGAGCCCAGCAGTTTTGAGTCTTTAGTGAGCCA
TGCTCACTGCACTCCAGCCTGGGAGACAGAGTAAGACCCTGTGTCTCTAAAAAATAAAAG
AAATTTAAAATAAAATGAAAATACAGATTATATGAAATAATGTATCTGCATGTTAACTAT
ATAAAAAGCTAATTCTTTATTGGACATTTATTGTATATCAATCCCAGTTCTATTTAGAAC
AGTTCTTGCCTATTTTTATTCATTTAATTCTCCTGATAATCTTATAAAGGTAATATAAAT
TTTCAGATGAAGAAACTGAAGCAGGAAGGTTAAGTAACTTACCAGCCAGGGTTACTTTGT
CTGACCTTAGAACCCATGGAGTTTATGTACAGAATCTGTGCCCTTGACAGTTTATACTAC
GTTGCCTCTCGGTAAAGCCCTCCTTGTAATGCCTGACGCCCAGGAGGTGATGACTAAGTG
GCAGCTATAGCCATAGTAGTTACCTCTCCTCTTCCCGTAGTTGTCCAAGAAAAAGGTAGT
ATATCAGCAGAATTACATTGGCTTAATGAAGGAGTTTCCAGTGTGAAAAAGCCACTTTGG
GAGCTAAAAATGTTTTAGATGATCACATGGCTTAACCAGAGTCTGACTGTAATTCCCAGG
GATGCTTTTGCTCTTGCCAAAATGCATATAAGTAAATTAATTACCTGCTGGTTTTTATGT
AGAAAGGGCTGGTGTCATGGTCTTAGCCATAACTTTGTTTGTTTGTTTGTTTGTTTATTT
GTTTTGTTGAGACAGAGTCTCTGTCACCCTGAGTAGAGTGCAGTGATGTCATCATAGTAC
ACTGTAACCTCAGTCTCCTGTGCTTCAGTGATCCTCCTGCCTCAGCCTCCCAAGTAGCTG
GGACTACAGGCACCCACCAGACAGAGACTCAAGTTGTTGCCCTGGATAAAGGGCTGTGGT
GTCATAGCTCACAGCAACCTCCAACTTGGGCTCAAGTGATCCTCTTGCTTTAGTTTTTCT
ATTTTTAGTAGAAACAGGGTCTCACTTTTTGCTAAGGCTAGTCTCTAACTCGTGAGCTCA
AGCAATCCACCTGCCTTGGCCTCTCAGAGTACTAGGATTACAGGCGTGAGCCACCGTGCC
CGGCCATCCATCAGGGTTTTAAAAATTTTTTTGTAGAGATGGATTCTCACTCTTGCAGTC
CTCCTGCCTTGGCCTCCAAGAGTGCTAGGATTACAGGCGTGAGTCACCACACCTGGCTTA
GCCATAACTTTATTATCATCTGCTTCACAAGAGGGAAAACAAATCAGGGAAGTGCTAAAC
ATTGCTGTTTCTATGGAGCCACCAAATAGCATTTCCACCATGGAGGCAGAATTATTATTT
CAGGAAGAAAGTAAAAGTGGAGAATATTTCAAGCAATTCATCAATGAGCAGGAACCTCCT
ATGTCCGGGGCAGAAGGAGCTCTAATTAGCATGCTGAGCGAGTTAATCTGTACCCAGAGC
ATTTTAATAGATTTGCTCTTTCTATACGGGAAGAGGACATGTTCTTCCAAGGTATAGTTT
GGTTTTTATTTGATCTGCTCAGTAGATTTAAACGCTTGCAGTGGCGCCCTCTAAAGTATT
TCAGTTGCATGATTCAGTTGTTTAGTGGTACCAGGCCTTAGTTATAGCAGGGCACTGTGA
CTCACACCTGTAATCCCAGCACTCTGACAGGCCAAGGTGAGAGGGTCGCTTGAGGGCAGG
AGTTCAAATTATTAAAGGAATTGTAAAAACCATGTGAGAGACTACTGGTCTTTACCACAA
AGGCAAAGGCTAAAGATGCATTAATTCGGTAACGTTTGCAGAGTGCTTCCTGTGTGTCAG
GGGCTGTGCCAGGCTCAGGAAATACAGGTCAGTATTCCTGGTTCATTAAAGTATGTGGAC
GTGTTGGGGAATCCATACAGTAAGGGCCTGGAAGTGCTGTGCTGGTCTGTTAAGGCACGG
TGGAGACTGAAGCTCGTGTCCTGCCATCCTTAGTGTCCATAGCCGCAACCATCATCTACG
CCTATGCCTGGCTGGTTCCTCTCGCACTCTGGGGTTTCCTCATGTGGAGAAACAGCAAAG
TTATGAACATCGTGTCCTATTCGTTTCTGGAGATTGTGTGCTGTCTATGGATATTCACTC
TTCATTTACATCCCCACGGCGGTAAGTGCCGCCCTTGTGGAGCAGATTCTGAGGGATGCT
CTGATCTTAGTTGAAAATTCAACCATGAATTTGATCAAGCAGTAATGTTTCCAGCCCAAC
CCTCATGTGCTCCTGAAAAATCCCCTTTGAATTTAGAAGTTCAGCATGAACGGGGCCTGG
GGAGCCCAGCGCCGTCCCTGGATCTTGAGCCCTTCATTATGAAAGCATTCGCTGGTCTAG
GTGCTGGTGCGGTTCCTCCAGCCTGTACTGAAAAGCCAGCGTTTTTTCAGTTGGGGCCCA
GCTGCTGATTGGCTCAGGGGCCTTTGTAAACATTTGTGCCTAGAATGAACAAATGCCTCT
CTGAAATGCCTCCAAAGAGCCCTCCCTCCCTCCTTTTCTCTTCTTTCAGATCCTGTGGAT
TATCCCACAGAAAGCTGTCCGTTGGATCCTCGTCACGATCGCCCTGGGCATCTCAGGATC
TGTTCTGGCAATGACATTCTGGCCGGCGGTCCGTGAGGATAGCCGGCGCATCGCGTTGGC
CACGGTGGTGACAATCGTCTTGCTTCACATGCTCCTCTCTGTGGGCTGCCTGGTATGGTC
TCCTTCCTGTATTCTTTCAGTGTGTTTTAAGTTGCAAATACTGAAAGACCTCAAACTGTT
AGATACAATGGTTCTTTTCAAACCAACTCCATGAAATAAATATAATTTTAAGTAGACTCT
CCTAGATGGGAACTGGTAAAATTTTGAGAATTTGTGACCTCTGGCTTTACCTAATTTCCA
TTATTTAGTTAAGATTCGATGTCTGAGCAGAATAAGTACAGATGAATCAGTGTTTATCTC
CTGGTATTTGGGGGAGGGTTGGTTTCAGGACCTGTTATGGATATAAAAATTCACAATGCT
GAAGTCTCTTCTACAAAAAGGGCATAGTATTTACATATCATCAACGTGCAGCTCCCCATA
TATTTTAAATCTCTAGATTACTTATAATAATACCTGATACAATGTAAATGCTATATAGTC
ATCATACTGTACTTTAAAATTCATATTACTTTCTATTGTCGTATTGTTATTTTTTCCTGG
TATTTTTTCATCCCCAGTTGTTTGAATCGGTAGAGGCGAAACCCGTGGATACAGGAGGCC
AAATGTATGGGGGTGGGGAGCTGGGATGGAGAGAATTCTGCCTTTGGGTGCCTTTGCTGG
TTTTCTGCACGTACCTAGAAAGATCTTTAAAATGAAAAGTTGTATAGGTGGAGGAAGGGA
ACCATCCCACAGTCGGGTGTTTAGCCAGGGCCTGTGGTGCCTGGGTTTGTTCTTTGCGAT
CGAGATTGCCTCCTTCTTCCTCCTCTGGAGATGTGCAGTGCAGGAAGGTGACCCAAAAGT
TAGATGACCTGGGTTCCAGTCCCAGCTCCGTCACATCCTGCTTTGGTTATTTCTTTTCTC
TGGATTCCGCATCGTCACTTAGAAAAAGGAGATGATTGTGTGCACTGTAGTAACATCTTT
ACCGATTTGTAGCATGAAAAATGGGGTAGACAAGTCACGCAAATGGAAGACATCATTATT
ATTATTGGAAGGGCAGAATGAGAAATTAGCAAGGGAGTTGTTTGAGCTGAGGGGCGCCGG
CTGAACCAGACAGCTTGGCTTTCTCATTCTCCCCTGGGAAACACAGATTGGTGTTTTTGC
CTTAGTTCAGCGAAGCATATGACAGCACCACGCCCGCTGAGGGCCCCTCGGTGATTGCAC
ATGTAAATGATCCCTACATTTGTACAGAACACACCTGGCAGGGATGACTAGGGAAGTACC
CAGAGGGTGTGTCCTTGGTTGCTATGTTTACAGAGGTACAAGCCTGTGTTTGTGGTGGTT
ACGGCTGATTTTAGAGGGAACTAGCCTTATTTCTATCACAGAGAGCCTGCCGACTCAGCC
TGAGGCCTCCCTGGTGCCTAGGTCTGGACTGGCCATTGTCGTCTAGGTGCTGACTTGCAG
GATGTGTTGGACAACCGGAGAGCATAGATTGTGGAGGCAGATCTGACTGGTTTGAAGTCC
TAGCTCAGACACATAACTGTGTAGCCTCGGGAAAATGTCCATCTCTTTGAGCCTCAGGTT
TCTTATCTTTAAAATTGGGATAAAGTTGCCCATTGCAGTTTTTGAACAGAGTAGTGGTCC
AGTACATTCCTGGGTGCTCCCCAAATGATTACTGTGGTTGTTATTGAGCTTCTGTGCAAT
GACCCTTAGAAAGCATCTTTTTTGATCTTTACATTTTACAGATAAGAAAACTGAGGCAGA
CTTGGGACCTGTGGCTGAAATGGCTAAGGCACCAGCCATATACACCTAAGGTGGCGGGTT
CGAATCCAGCCCAGGCCCGCCAAATAACAATGATGGCTGCAACCAAAAAAAAAAAAAAAT
AGCTAGGTGGTGTGGCTGGTGCGTGTGGTCCCAGCTACTTGGGAGGTGGAGGCAGGAGAC
TTGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTATGATGCCACGGCACTCTACCCAG
GGGGACAGCTTGAGGCTCTGTCTCAGAAAAAAAAAAGAAAGAAAGAAAACTGCGTAGGGC
GCTGGCCCCATATACTGAGGGTGGCCGGTACACACCTAGCTCTGGCCAAACTGCAACAAA
AAAATAGCCAGGCATAGATGGGCAGCACCTATGGCTCAAAGGAGTAGGTCGCCGGGCCCC
ATATACCAGAGGTGGCGGGTTCAAACCCAGCCCCAGACAAAAACTGCAAAACAACAACAA
CAACAAGAAAAACAGCTGGGCGTTGTGGTGGGCGCCTGTAGTCCCAGCTACTCAGGAGAC
TGAGGCAAGAGAATCTTCTAGGCCCAAGAGCTGGAGGTTGCTGTGAGCTGTGATGTCACA
GCACTCTACTGAGGGCGACAAAGTAAGACTCTGTCTCTTAAAAAAAAGAAAAAAGAAAAA
ATAACTGATGCCCACACACCACCCAGGGTGTAGTGACCTGTCCAGAAGTCACAGTACAAG
TTAGTAGCACATACAAGCTGGGCCTCTCAGCTCTTACGAGGTTTTCTTCATAGCCTGGAA
GAAAGGCTTTGTTCCTGCACCCTCGTGGCTTGTGGCTCAGTACACCCTGGAGAGATGTGG
GGGGCTCCACGCTGGCCATGTGACCCCTGTCCCCACCTAAGGTCAGGTGCTGTTCTTTCT
CTGTCCCAGAAGACAGCTGCTCAGGAGGCACTGTGGAGGAGACTTTTAAAAGCGATAGAA
TTGCGTGGCCCTTATTGAAGCTGCAGGTGCTTCCACATCTCTGCTGTGGTCAAAGAGGAG
CCAGAGTCACAGTTTTCCTTGATGGTTGCCGTTGTGTTTGCTGTGACTGATCTGCAGCAT
TTTGGGAAAATACAGTTTAAAAAAAAAAACAGAAAAAGCAATAGAATTGCTCTGGGAATA
TAACAAACTAGATAGAGGGAGGGTTCTGACAAAAAAAGGTGCTATTTGGAAACTTTGAAA
GGACTGTTGAAGAGTTAACACAGTGCAGCCGTGTTGGGGAAAGATCCACCGCGTTGTGTT
GCTGCCCCCTTGTGGCTGACAGAGAGCAAAGCTGCTGGGAAGTGGTTCCTGGTGGCTTTT
TTTATTTTTTAAACAGGGTCTTGTTCTGTTGCCCACTCTGGAGTGTAGTGGAATAATCAT
AGTTTACCACCATCTCCAACTATTGGGCTCAAGCAATCCTCCCACCCCAGCCTCCTGAGT
AGGACTACAGGCTCGAGCCACCATGCCCAGCTAACGTTTAAAACATTTTTTTAGAGATGG
GGTCTTGTTATGTTGCCCAGGCCGAACTCCTGGCCTCAAGTGATCCTCCTGCCTCGGCCT
TCCAAAGTGCTCGGATTCCAGGCATGAGCCGCTGTGCCTGGAGACTTGGAGACTTGGTGG
CTTTTTAACTTTTTACCTTCCTCAGTCACTGACACCAAGGGGGAGTGGCGAGCATTCTGT
GGTCCTTGACGCAGTAACAGAGTCACCTTTCCTTTGAACAACTGGTGTTCGGTGCTGGTG
AGATTAGTATTTTCCTGGACTGAAGTTAGGATTCTTAGACTTTGAGGCAGTGGCGAAATC
TTCCCTGTTGTCTTCCCTCCTCCACCTCCTTCTCATTTTCAACAGTTAAATTGTAGACGG
TGAATGAAAGCAGCGACAAAACCTTTCATATCCCAGCGGAAGAAGCAGGAGGCACAGCGC
GCTTAGCGCTCACTTTGAAGGCCTTTGCAGAGAGCCAGCTAACTGGCTTAGCAGCGGTCT
AACATAGGCGACTTTATTAGCTATTGATTGTTTACATAGTGTGCCAGGCCCGTGTGGGGT
AGTGGTGACACAAAGATTAAGAAGGATAGTCTTTGTCCTAGAGGAAAGGCTGCATCATGT
AGTGAGTGGGAGGTTGTGCTTAGAGTCAGACTGACCTCACTTTGAGTCCTGGCCTCACGA
CGCGTTAGCCATGTGCACCCGTCAAATGACAGTCTCTCTGAGCCTCGGCTGCTTCATCAG
TCTAAAGAGGATAGTCAATACCGCCTCGCAGGGTTTTTATTAAGTCGTGTTATATAGTAA
GTGCTCGATAAATGAGTGGTAACTGAATTTAAAAAGGTACTCACAGTTGAGTAAGTGAGA
CAGATATAAGCAGAGACAGTTGTCATTTAGCAGGATGAGAATAGTGGGGGGAGTGAGGGA
CCAGGAAAGCCCAGTCGTACCCAGTCAGCATGGCGTCTAGAACGTTCGCCCAAACCCTTG
TTTTTAACTCCCTCGTGGTTCTCTTTTCCCGCAGGCGTACTTTTTTGATGCACCAGAGAT
GGACCATCTCCCAGCACCTACAGCTACTCCAAACCAAACAGCTGTGGCAGCTAAGTCCAG
CTAGTGAGGAAAGTAAGAGATTGTGTTTTTATCTTACTGCTGTGGGATATAGTAAGAGGC
GGGCAGGTACGTCACTGCCGTTACTGTGATCAGGATCAACAGCAGAGAGGGCCAGACCCT
TCTCACTTTCTGCCCGGTTCATGTGCGTCCGTGTGCTCCTTGTTGAAGGCTTCCATTTTG
AAACTCACATGATGTTCACTTTATACAAGTGGGGAACATAAGTTCAGAGATTCTTCTGTA
AAGGGAGCTCCTGCCTTTAGACCCAGCAGAGAAGATTCTCCTTTCCTCTCTGAACACTCT
CCACCAGCGTGGTATGGGTTTGTTCCATTTGCTAACAGCCCTGGCCAGTTTCCTTTCTAG
TATCTCTAAGAATTTTCATGCTGGCCTCAGACCTGAGCGTGACCCCTTTCAAAACACTCA
CGAAGTTCTCCAAACCTTACACGTTTTCATGCCTCCTTTGCTCCCAGGGCCTCATTGATG
ATCCCACTGTTAACCCAGTGGGTTAGAGTATAGGAAAAAGACCCCACTCCACCTCTGCAG
AATACTGAAGCCACAGCCACGCTGATGGTCTTGCCCTTTCCTTTGTACTTGCTGTTACAG
TTGTTGGAAACGTTCCTTCTTTTCCAACAGTCGTCACTTACCTGATGATCCCTCACACTT
TGTATTGTACGTCATGTGTTGTGGGTGCTTGAAACACTAATCATTGGCTGTGTGTCCATC
TGCCTGTCTGTCCATTTGTTCAGTGATTCACTTGTTCATTTGTCCTCTGAGTACTAGAAA
GTCTCCTCAGTTAGACTCCTCTCCATACGAACGAGGAATGGTGTTACTCTATGTCTCCAT
TGCCCCCCCATAACTTGGTTTGTAGTGGGTGCTCAGTAAATGTGTCTGGAATGAATGAAT
GAAGCCACACTCTGCACATGATCCTGCTGTGGCCAACAACGTTTACTCTGTGTTATAATC
ACAGACTGTGCTTTCTGCCCAAGTTGCTGCTTCCTAGAGCACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 10200..10363, 15223..15303, 15529..15616, 23265..23381, 30873..30999, 31001..31040, 31429..31611, 35794..35883
1001..1031, 10200..10363, 15223..15303, 15529..15616, 23265..23381, 30873..30999, 31001..31040, 31429..31611, 35794..35880
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved