Otolemur_garnettii Locus EEF2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii EEF2
Otolemur_garnettii
EEF2
GeneScaffold_3953
SNORD37
4042..4106
10613
CTCCCCCCTCCCAATTTACAGAAGAGGAAACTGAGGCCCAGAGAAACCCTACTAGATAG
TGTAAAAACATGCAGTTTGATGAAGCCAGGAAGGCATTTTATTCACTGTTTTATCCACAT
TTAATAATGCCTGGTACCTAGTAGATGCTCAGTAAGTACCTGTGGGCTAAAAGTGATTAA
CCACCATTTAAAAGTATACATAGGATTTCAAGTTATTATCGGTACATAATAGTTGTATAA
TACCTGCTTTTTTTTTTTGTACGAAAGGTCTTTATTGGTGGGGGGAGGAAGGCTGCAGAG
CAGCACCGAGAAGAGAGGTGAGAGAGATAAGGAGAGAGTAGGGAAGAGAAGAGAGAGAGA
GAAGAGAAAAGCAAGGGGAAAGACGGGAGAGAGAGAAGGAAGGCAGAAGGAGGCAAGAGA
GAATACCTGCTTTTTAAAAAGCTTTTTATGTTGAAATAATAGGCAAGAGGTTGACAAACA
ATACAGAGAGGTCGTGAGTGTGCCTTCTCTCAGCTTCTGCCACTGGTATCTTCTTACATA
ACAATGTCCAAAGCAAATTGACTTAGGTTATCATCCACAGACTCTATTCACCTTGCACTG
TGCTTTTAATAGCAGTACTTGACATTTTGCAAACTAATACAGTTTTTCTGATTATTATTC
TCGCTAAAACAACGCTCTCCGCTTTATGCACCTCAACAGTGCACACCACAGTGCAGGCCC
AGGATGGATACGACCACTGCGCCTCGGACGCCGGCCCCTTAACCTATTACAGGCCAGGCC
GGCACCCAAAGGGTTAACTAGGAGTCGCACCTTTGTGCGCCTGCGTGCCGCGCCTTGTTG
TCCCGCCCCCGCAACGCAGTCATATGACCCGCCCAGCCGGCGTCAGCCTACAAAAGGCTC
AGTGTTGACGTCAGCGTTCTCTTCCGCCGTCGTCGCCGCCATCCTCGGCGCGACTCGTCT
CGCTTGGTTCTACCTGGGAGAATCCACCGCCATCCGCCACCATGGTGAGTAGCTCTGTTC
AGCTGTTGTCTCGGAACTAGGGCGGGCCCTCTGCGGGGCCGGCGGCTGCCTACCCTGGGA
GCGCTGGAGCAGACCGGATAAAGAGTATACATGGCGGCGGCTGAGTCGGGGATGGGGAAG
CGGCGCCGCCATGTCGGCGCGCCGCCGTCTTCGCGGAGCCCCTTTCGGATTTCGGGGGCG
CCGTTCCCTTATGAGAGCACGGGCCCGGCTGGCTCTGGGTGGTGGCGGGAACAGGGGTGG
GGTACGATGATGTGGCAGAGGTTGTAATGGCGGGCACCGCTGTAGAAGTGGAGAGCTGGG
GTGGCGCCTTATGTAACCCGCACGCCGCGAGTTTGAGTTCGATTTTTTGCCGGGGACCTT
GGACAGCGGGGAAATAGCAAAACAGGGGAAGCGACGCAAGTAAAATTTCTCTTTGTGGTC
CGAAAGCCTCGTGATAACTGGAGCCTTGGCCTTGGTCTTTACTTTGACTCCCCAGTGGGA
AAAGCTGGCGTCTAAGCCATGGGGCATGGATTTTTGACGGTTAGCGTTGTTTTTGAGCTT
TGATATCCCGGTAGTTGTGGCTCTTTCTGATTCCCTAGGGAAAGGGATGACCTTGCGTTT
TAAAGAAGGTTTTTTTTTTTGGTTGAGAGAAGCCAGGGTGGCCCAACAGCAGGTTGGAGA
TGGTTTTGGCTTTATTAGTTCCATATTTGACATGTAGAATTTTCTAGTGTTGTTTTTGGT
GTTAAAGAAATTGGTCACGTTTGGGGACCGTTCTGTGTCTTTTGGGTTGTGAATTCTGAA
TGACAGCTGGAATCAGTGGTGCCTTGAGATTGGTGGAGTGCTTTTCAAGGGGCAGGGTTG
TGGGCCACCACAGCACCATCCCCTTCCTGGCCTTTGACCTGGCAGTTTTGGTATTGACTG
GATGTTTTGTGCCAAGCTGGGTTCCCAGAATTCCAGGCTGATCTGAGCCACCTCATTTCT
CTCAGGTGAACTTCACGGTAGACCAGATCCGGGCCATCATGGACAAGAAGGCCAACATCC
GTAACATGTCTGTCATTGCCCACGTGGATCATGGCAAGTCCACGCTGACAGACTCCTTGG
TGTGCAAGGCAGGCATCATTGCATCGGCCCGGGCTGGGGAAACACGCTTCACTGATACCC
GGAAGGATGAGCAGGAGCGTTGCATCACCATCAAGTCAACGTAAGCTCTCTGGTGCCCTG
TGGACCTGGGTGGGTGACTGGCTCTCTGGTTTGGCAGCTAGCAGCAATGGGCTAAGTTGG
TGGGAGAGACCTGTGGGCACCATCACTTTCCTCCTCGGACCTTCCAGTGAATCTTGGGAT
GTGTTAGGGCCTGTGTCATGCTGTGGGGGAGAGTGAGGTTCTATCCAGGGTGACAGCTGG
GGGAGGCACAAGGGTGAAAGGGCATTGGGAGCTAGGGATTCTTGAAGCGGGGGTTTAACC
TATAGTAGTTCTCACTTTTTTTTTTTTTTTTGAGACGGAGCCTCAAGCTATCCCCCTGGG
TAGAGTGCCATGGCTTCACAGCTCAGAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTC
CTGCCTCCGCCTCCCAAGTAGCTGGCACCACAGGCGCCCGCAACAACGGCTCGACATTTG
GTGGCAGCAGCCATCATTGTTGTGTGGCGCCCGCGTGCTGATGATACGACACCACCATCT
TAGATGTATGTTGGTGGCGCATCAGCCTGATGAGCCAGTAGTTACTACTGTTGGGGGGGA
GTATATACGACCCCGAAGCACTGCTAGCAACATCAGGAGATTAGGTCGCTCCTTAGATAG
AGAGAATGTAACTGGTATGTATGGATGAAGAAAACAGCCTGTATGGATGGGTTCCGCTCG
CCGTGTTTGTCTCGACACCAAAAACGAAAAGAATGAGAATGGCATGGGCAAGCACAGGGG
ATGGTGACCATCAGTGCAATCTATTACCAGCTATTAACGTTGTAAGGTTCTCTCTGATCA
ATCTTAGCTGGGGCTAGAAAAGAAGAAAGGGCAAAAGTGGTCTCTGGGGTTTCTTTAGTC
TTGCCTAGTCAGTATTTTGAGTCATATGTGACGTATGCAGAGGCATAAGGGGCTCTGAGG
AGCTGGTGTGGGAGATTGGTACCTGGAGTCCCCATCCCTGGTAGAAGTAGAGGGTGGGTC
AGCTCTTGTGTGGGAAACCTGAGGTCTGACTCTGGGGATGAATAATCAAGAAGGGGAGGG
GACAGGGTGGAGAGTGCTGAGTGGTGGCTCTGGCTGTTGGGGCTCCCTTGGGCAGCAACT
TAGGGTGGGTAGGATAGCTGATGGCCAAGTGTGGCTATAGTCTTAACCTACCCTTCTCTC
CTTAGTGCCATCTCCCTTTTCTATGAGCTTTCTGAAAATGACTTGAACTTCATTAAGCAG
AGCAAGGATGGCTCTGGTTTCCTCATCAACCTCATTGACTCTCCTGGGCATGTAGACTTT
TCCTCAGAGGTGACAGCTGCCCTCCGAGTCACCGATGGCGCCTTGGTGGTGGTGGACTGT
GTTTCAGGTAAGCAGCAGGTCCTCTGCGGCAGGGCCTTGAGGGATCTTGAGCCATCCCCG
CCTCTGGATGATAGGTGCCCTTTTTTCTGCCTGTTCGTAGGCGTGTGTGTGCAGACAGAG
ACAGTGCTGAGGCAGGCCATTGCTGAGCGCATCAAGCCTGTGCTGATGATGAACAAGATG
GACCGTGCTCTTCTTGAGCTGCAACTAGAGCCTGAGGAGCTCTACCAGACCTTCCAGCGT
ATCGTGGAGAACGTGAACGTCATCATCTCCACCTATGGGGAGGGCGAGAGTGGCCCCATG
GGCAACATCATGGTATGTGTCCCTGCCTATTCCCCAGCAAGTTGAAGGGCTTTCTGCCTG
GTCCAGGAGATGTCCTGGGGGATTCTGAAGAATGTTCACCCCAGGAAACAGGTTGGGAGA
GAAGAAAAAGGCTAGAATGTTTTTACATCTGATTGGATCAAACCCTTGAGATTTGCCTGC
AGGTGGGGCTGGGTGGGCCCTTGTACATGATGACTGACATTTCTTCACTTTGACCTGACG
TCTACTGAAGAAATCTAGTATCTGAGGCCTATGGTGTTTGGTGGAGTTACAGCTGCAGAT
TTGCCCAGGGCCCCACTATTAAATGCTCCTCATTTTTTTTGTGTTTTCCCAGATTGACCC
TGTCCTTGGCACTGTGGGTTTCGGGTCTGGCCTCCATGGTTGGGCTTTCACCCTGAAGCA
GTTTGCAGAGATGTATGTGGCCAAGTTTGCAGCCAAGGGTGAGGGCCAGCTTGGGCCAGC
TGAGCGGGCCAGGAAAGTGGAGGACATGATGAAGAAGCTGTGGGGTGACCGGTGAGCCTC
ACAGGGAGGGGAGGACAGGGCAGGGGGAATCTGTGACACTCCAGCAGCGTGATGTGTTCA
TGACACAGCTCAAGATCACCAGACACCTTGTGGAGTTCTGCCCATGCTCTATTTTTCATA
GCTATGTGGGTTTCTTGCAGCCCCCTAAACTGGTTGGGATGGGCTTTTTCTCTACTAGGT
ACTTTGACCCAGCCAATGGCAAATTCAGCAAGTCAGCCACCAGCCCTGATGGGAAGAAGC
TTCCCCGGACGTTCTGTCAGCTCATCTTAGATCCCATTTTCAAGGTGAGGATTAGAACCC
AGTTGAGCCCCACAGCAGGTGCTCATGGTCAGGCATCTCTGTTAGTGGTATAAAAAACAT
CTTTTCAGAGGGGCACCTGTGGCTCAAAGGAGTAGGGCGCTGGTCCCATATGCTGGAGGT
GGCAGGTTCAGACCCAGCCCCGGCCAAAAACTGCAGAACAAAAGAAAAAAACACATCTTT
TCACCTAGAGCTCCTAACGGTCACCTGAGCCACTTATGGTAGCTCACAGTGCAGGGTCAG
GAGATACGAAGATGGGGGAGAAGGCATTTTTAGACTTGCAACGTGGGGACCAGAGGGTTC
CTCTAAATAAATGGGGGTTAGGTGCGAGGCCAGTTGGGACCTTAAGCTGAATTTACAATG
TCGTTATTTTAAAATTTTTTACTTGCCTGTTAGGTGGCTTCCCCCCCCCCCCCCCCAGTA
AATTTCCATTAGGCTTTATCTGGATTTGATTAGTTGGGTCATGCCCTTGGGGGGAAGGGG
GTCAGGCTTTATACAGGGTAGCTGCTGTTCCATGCCTGGTTTAGGCTGAAAGCAGCAGGT
TATCTAAACTCTTCCCGGGTGCACTTTCTTAGGGGTTTCATGCAATTATGAATTTCAAGA
AAGAAGAGACAGCAAAACTGATTGAAAAGTTGGACATCAAGTTGGACAGTGAAGATAAGG
ACAAAGAAGGCAAACCTCTGCTGAAGGTGCGTGAGGAGGTTCTGGCCCCTATGGAGAGCT
AGTTTTTAGTAGTCATTTCTGAACTAAGGTTGCCGTTTTTATGGGTGGTCAGACCCTGGT
CTTTGGGTGCTGAGATCCCATCAGGGAGATGGCTGTCAGTCTCTTGTGACCTCTGGTTCT
GGGCTCTTTTCCTTAAGGCATTGCGTCCGGCCTCCTCTGGGATGGTGTGTATGGGCAGGC
GTGCACACAGCCTGGATCCCCTTCTATGAGGGGTACACTTTTTAGGGAGAACACAGTTTC
TTACTGTTCACTTAATAGCTCCCTGAGAAAAGAAAGCTCATCCTGGGGTGCTTCCAACTC
TTGTGCAAGCCCTTTTGTTTCTGTCCCACAGGCTGTAATGCGCCGCTGGCTACCTGCTGG
GGATGCCCTATTGCAGATGATCACCATCCACCTGCCTTCCCCAGTGACGGCCCAGAAGTA
CCGCTGTGAGCTTCTGTATGAGGGGCCCCCAGACGACGAGGCTGCCATGGGTATGTGGAT
CATGGAAATGGCTGAGCTATGGCATGTATCTCTGGTCAGGATGCCTTCCAGGGAGGGACT
CCAGAAGGATAGACTGCATAGCAATAAGGCTTTCCTATCTGGGTTTTATCTGTCTTTAGG
CATTAAAAACTGTGACCCCAAAGGCCCCCTTATGATGTACATTTCCAAAATGGTGCCAAC
CTCCGACAAAGGTCGGTTTTATGCCTTCGGACGTGTCTTCTCGGGGCTGGTGTCTACCGG
CCTGAAGGTCAGGATCATGGGGCCCAATTATACCCCCGGGAAGAAGGAGGACCTCTACCT
GAAGCCCATCCAGAGGTAAGCACTTCGGCACTATCTGTGGTCGGTTGCTTCCCTGTTCAG
TACGTGGCTCAGGAGGGTGTGGAGAGGGTTAGTGTTAAGCTATTTCCAGCTTATTTTGTC
ATCATGGCCCAGTGAGGATGAGTAAAGTCTCTGAGAAAGCTGATCAACTGTGTGTGTCGT
GAAGCCCAGCTCAGAGTTGGATGTAAATGTCCTTGAGTTCCAGGCAATGGTCTTGTCCCA
TGTTCAGAGTGGGCAGTGAAGGTGATGTTTAATGGCATCCCCACTGCAGCAGCAATTGTG
GGTTGGCACTTGTTCCAGCTCCTCAGGAGTCTGATGTGTGTCACGGGCAAGTTGGTGCGT
AAGTTAGTTATCTGGGTTACGATTGGAATGCAGTCAGTTCTTAGCTCCAAAAAGGCCTTG
GCTTGCTTCTTGGGATGTGACCTGGCTACCTGGCTTTTGGCCTACTGACCCCTACTCTCT
ACAGAACAATTCTGATGATGGGCCGCTACGTGGAGCCCATTGAGGACGTGCCTTGCGGGA
ACATCGTGGGCCTGGTGGGTGTTGACCAGTTCCTGGTGAAGACAGGCACCATCACCACCT
TTGAGCATGCCCACAACATGAGGGTGATGAAGTTCAGTGTCAGCCCTGTTGTCAGGGTTG
CTGTGGAAGCCAAGAACCCAGCTGACCTGCCTAAGCTGGTGGAGGGGCTAAAGCGCCTGG
CCAAGTCGGACCCCATGGTGCAGGTAGGCATGGGAAAGCAGATGCCACCTGCAGAGGAAG
GATTTGCTGTGGTCTGAGGTGTGGTTGCTATGGTTTGGAGATTTGAGATATTTGTGAAAG
TAGGGATCTCTGGTTTGTGGTGGGCCTGCATCTTCCCAGGTAAAACTGCTGCCTTTCAGG
TGGTAATTTCTTGCCTAGGTAACTGCTGCCTCCCTTTTTTAAGACTGCTTGGATTCTACA
TGTCTACTGTGGGTTGTGAATCTTAAATTTGTTCAAGGGTAGTGTGGGCAGGACCTGGTA
GCAGGGCTTACAGGGCCTCTTGCTGCCTTTGGGTGTTGCAAATTTCTAGCACTGTCCCCT
AAGTTGTTTTGGGGGCAGGTGAGCATCTTCTATCAACTGGAGGGTACATAAGGCTTGCTT
TGTGCCCATCCTTTGAGTCCACAGTCCCCAGACTATCCCTGAGCCTACGCGTGATGCTAG
GCCAACACTCAGGACTCAATCTTGGCCTTTTCAGTGCATCATTGAGGAGTCTGGGGAGCA
TATTATTGCAGGCGCCGGGGAGCTGCACCTGGAAATCTGCCTGAAGGATCTGGAGGAAGA
CCATGCCTGCATCCCCATCAAGGTGAACAAGGGTGCTATGTCCACACCCTTCACACCAGC
CTCCCTAGGCCTTGCCATTGGGTGTTCTGCTTGTGAATTATGTGCATGCTAGCTTTCCCT
TATTCTTTATTTGTAAGAAAATAGCAATATGCTCAATGGGCTCAGACCAGGCTTGCTTGC
AAAGCTTTGTTATCTTCCAGTGGATGCTACTGTCTCTCCTGGATCCTGCAGGCAGTGGGT
ACAGACTTCAGGGTAGACCACGCCCCTGTACTTAACAAACATGGTTCTATTTATTCCAAT
TTAATACATCACTGCTGTGTTAACTGTCTGATTGGGAAAAGCTTTAGGAATTCTTCTGCA
AAGATCACCTCTCCCTTCTGGGCTGTGACCTGTTTCTTCCTTTTGCAGAAATCTGACCCA
GTTGTCTCATACCGTGAGACAGTTAGTGAGGAGTCCAGTGTGCTCTGCCTCTCTAAGTCC
CCCAACAAGCACAACCGGCTGTACATGAAGGCTCGGCCCTTCCCTGATGGTCTGGCTGAG
GACATCGACAAGGGCGAGGTGTCTGCCCGCCAGGAGCTGAAGCAGCGGGCCCGGTACCTG
GCTGAGAAGTACGAGTGGGATGTGGCTGAGGCCCGCAAGATCTGGTGCTTTGGGCCTGAT
GGCACTGGCCCAAACATTCTCACTGACATCACCAAGGGTGTGCAGTACCTCAATGAAATC
AAGGACAGCGTGGTGGCTGGCTTCCAGTGGGCCACCAAGGAGGTGGGGACATAGCTCTTG
TGAGCCAAGTTGGTAGTTCAGTGGGATGCTGGGGTCAGGCCTAGGAGGCAAACACTTGTG
TGAGAGTATGGGTACCTCATCTGTGGTCTGTGGCTCCTGGTGAGGATGAGGGCTGCTGAG
GTAGGCAAGATAAGCGGGACCCTGGTTTGCTTGGGGCCCCAAAACCTGAAGGGCTTGACA
GAGGGGAACTGAATGTGGCTCTGTCTGACCTCATAGGTAGCAACTGTTGTTAAGGATACC
AATGCGGGATGTGACCTTTAGAGGTCCTAAATTGACTTTTGCATGTAGAAGCCATCCACC
TGTGGGGGTGGACAGATCATTGCTCAAGACCGGGTATACTTGTATACTATGGTTTGTTTT
ACTCTCGCCCTGCTTCTTGTTGTCCATCCACTCTATTGGAATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTTCATGGCAGTGTC
CAGAACTAGTGGTCGGTGGCATATACGGTGTACTGAACAGGAAACGGGGCCATGTCTTCG
AGGAGTCCCAAGTGGCTGGCACCCCCATGTTTATTGTTAAAGCCTACCTGCCCGTCAATG
AGTCCTTTGGTAAGTGGCAGCTAAGTGCTTACAAAGCTCAGCAGGCTGTAGTCAGGCCAG
GCCAGGAGGGACAGACGTCTAGCTTAATTTAGGCTTGGCAAGGCGTGTGGCCTGGGCTTC
TTTGGGAGCAGTTGGTGTAGCCTGCTGCATTTTGCAATTGGGAGGCAATCCAGTCTTGAA
CCCTATTAGACCCCAAATCACTAAGCATAGGGGGAAAGGTTCTGCTACCCCAAAGTTCAG
AAGGCTTTTGGGTGTGTAGTTTAGGGATATCTCAGGGATGGGGCTAAAAGAGTAGCTGGG
CTTTAGCTCACCACCATAAAGGGCTATCTTAGTGCCTAGTTGTCTGAACTGAGGGGTAGT
GTCCTAGTCATTTTCTCATACATGTGTGCCTGTGGGGCCAACAAGGTATCATAGGTTCCT
GTAGGACCCACTGTTCCTGGGAAGACCAGTGAGTCTTGTCCCTGTTCTTTACCCCTACAG
GCTTCACTGCTGACTTGAGGTCCAACACAGGTGGCCAGGCCTTCCCCCAGTGTGTGTTTG
ACCACTGGCAGATCCTGCCCGGAGACCCCTTTGACCACACCAGTCGCCCCAGCCAGGTTG
TGGCAGAGACCCGCAAGCGCAAAGGCCTGAAGGAAGGCATCCCAGCCCTGGACAACTTCC
TGGACAAATTGTAGATGGCCCCTGCCGCAGCACCCCCCACTTCGGTGGGAGGGGCTCAGC
ACCCACACCCAGTTTGACCACAGCAGCACGTCCTTACATTCTCAGACAACACCTCGAGAC
TGTCCCGACACGACACAGTGATGTTCTACCTGAGAGGTTCTGGGGCCATCGCTCAACGTT
AACACTTGATGCCGTTTCTTTTGATATTTATTTCCAGATTGCGTGGGCAGCAGAAATGCC
CTTTTTACAGGGACCGATTTGGCCGGTGGGGCAGTGGGAGGAGGGATGGGACATTCAACT
TTTTCTTTCCATTTCTTCAGAGGGAAACTCAAGATGTCCAAAAAAAATTTTTAAATGAAC
GCATTAAGAGGTATATTTGGGCAAATGGTCCGTAGTGGTTTTTTCCCCCAGAAAGGAGGA
AGGAACAGCGGGTAGGTAATTTCTAGAAGGCAGAGAGTCCTGTGTGGTGTGACCATGAGC
AACTCCAGCTGTTAGTGCCATTGGAATAATAAATTTGATACGGTGGTGACTTCATTCTGC
CTCATTCTTGTGGCATTTTTGCAGGGGAGCAGGGCTCCCACAACCCAGTATCAAGGCCAC
AGTGCTATTTTAGGACCAGAGGTCAATGTAGCCTAGAAGGGGTAATCGAGTGCCTGAGAC
CCAAGGGGCAGAGGCTGTCTCAGTAGTGGGTGCTGCCGAGTGGAATTCAGTGGGGTGGTG
GAGGTGGGATTGCTGAGGACAAGAAGTAGGACAAGTGCAGCAAGGAACTGAAGTTTTTTT
TTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGCAGAGTGCTGTGGCAT
TACAGCTCACAGCAACCCCCAACTCCTGGGCTCAAGCGAGTCTCTTGCCTCCACCTCCCA
AGTAGCTGGGACCACAGGCGCCTGCCACAACGCCCGGCTATTTTTTGGTTGCAGCCGTCA
TTGTTGTTTGGCGGGTCCAGGCTGGGGATTCGAACCCGCCACCTTAGGTGTACG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1985..2199, 3365..3546, 3640..3851, 4192..4370, 4558..4663, 5252..5365, 5731..5869, 5999..6194, 6664..6922, 7414..7521, 7908..8261, 8496..8500, 8502..8506, 8509..8519, 8521..8532, 8534..8551, 8555..8579, 8581..8628, 8631..8644, 8647..8685, 8816..8948, 9420..9613
1001..1003, 1985..2199, 3365..3546, 3640..3851, 4192..4370, 4558..4663, 5252..5365, 5731..5869, 5999..6194, 6664..6922, 7414..7521, 7908..8261, 8496..8500, 8502..8506, 8509..8519, 8521..8532, 8534..8551, 8555..8579, 8581..8628, 8631..8644, 8647..8685, 8816..8948, 9420..9610
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved