Otolemur_garnettii Locus RPS13
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPS13
Otolemur_garnettii
RPS13
GeneScaffold_1286
SNORD14, SNORD14
2362..2450, 3751..3840
5045
ACTTCTCACCAGTTAAACTTGACTGAATTTCACAGGCCTCCCTTAAAGCCGGGGCCATG
CTTACTTTTTTTTAAAACAAGCTGCTTCAGGGGCGGCGCCTGTGGCTCAAGGAATAGGGT
ACCGGCCCCAGATACCGGAGGTGGTGGGTTCAAACCCGGCCCCAGCCAAAACAAAACAAA
AACCATATATATATATATATACACAAGCTGCTTCATTTGCCCATTCTTTGGCCCACTGTG
TCAGCATTGGGACATTTTTGTAAAAGAGCTTCCACATTGGTGGCTCCCTTTTCTCAGTTG
AGGCGCCTCATTTTCTCCCTCGCTTTTGCAGGCTTGTTCCATAGGCTCTTCTCTGCCTAG
CACTAAGGCTGATTCAAATCTTTGAGGCCGGGTCGTTGCCGTCAGTTAACTCTTCCCCTG
GCAGATGAGAATTAGAAATAATAGATGGAAGCGCAGGTTGGGTGGGGTACACCGCCATCA
CTTCCGTGTAACTAGCAGTTATCACAGCGTACCGTGCCTGTGAATTTCCTAAGGGCAAGG
ACAGACTTTGAGGGATCCATCCGGTGCCAAGACAAAACTTGGCAGGGGCTAACGAATGAG
CGCTAGCGTATAACGGATCACTCCAGCTTTATTGGCTCCAAGCTTCCCGCCCCACGACTG
GAAACTACAATCTCGGCGCGGGTACCACTGCTCTCTCTAGATGCGACCCGCAGCAGCGAA
CTTTGATCGGAAGTCGGCTCAGACTCAACTTCCCGCCCGGGCCTGGAGCCTGACCAAAAC
CCGGTGCATGCCGGGATGCGCGTCCGGCCCACGGAGGAATCCAGAGCGGCAGTGAAAGGC
ATTTCGGGATGTGTAGTCACGCGAACGCCGGTAGCTGAGCAGCGTGGCTCCGCCTCCCGC
GTGCGAGGGTACGGGACGTGTGAGGTCACTTCCTGCGTGCCGGGTGGTTTCCTGCAGCGT
TCCGAGACTCGATCTCTTTTTGCTGCTTGCCTGCCGCCATCATGGGTCGCATGCATGCTC
CCGGGTGAGTGTGGGTACCGAGCAGGATTGCGGGGCTAGACCAAGGGGGTCGGGGGAAGA
AGGGAGTGTGGGGAGCGAGTTGGGAGGGGTGTCCTGGGGTGATGTAGCACAAGCCGCAGT
CTCACACCAAGATTGCTTCTGTCCTCAGAAAGGGCCTGTCCCAGTCGGCTTTGCCCTATC
GTCGCAGCGTTCCCACTGTAAGTAGCGCGCTGGGACCGGGGAAAAGCCGGGGATGAGGGT
GGCCTCTTGCTCGGAAGAAGGTGCACCGGAGTGGGACCTGTGCGTACGCGGAGCGCGCCT
TTGCGGGTGGAGGGGACCGCTGTGCTCGCCACAGCCTCAGGTTTTTCATCCTAAGGCCGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTTGTGTCTAACGTAGCCCCTACCGCCTGCCTTCCTGCGTCT
TGAAGGAAGTTTTAGCAGAGTCCAAAATTTTAATGAGCATTTACTGTGTGTAGGCTTCTA
AGGCCACTTTACAACACCGACTTCATTTCCCCGTTTTGATTTGCGGAAACTGAGGCACGT
GCAGTTAAATGTTAGCCCCAAATTATACGACTATTAAGTAGTTAGAATTTGCTACGCAGT
CTTCCACACACTTTCTCAATTTTAAATGTGTTTGAATCTCAGCGGTGTGTAACTTTGTGC
AAGTGGCTTCATTTAACATATATTTGCCTGTTAATGTTAATGAATGCAGTTCTGGGCCCT
GAGAATACACTAGTCCAAAGAAAAAGGAAAATATATCTGCTTGTGTGGATCATACAATTC
AATCGCGTTTCAACACATGCATACAAAAAGAAAATACATAACAGACCTTAGGTAGCCAGA
ATTAATTTGAGTTTTAAAAGAAATGATATAAAGTCTTTGGATGAATAAAAGTTCTTCCTA
AATATTAGCTAGTTTTAATTGTAGTATATATGGACTTACAGGAATTCTATTGATTGCTTT
GGTCATCTGTATTCCAGCAAGCTCACTATGATGATGGTTTTCCAACATTCGCAGTTTCCA
CCAGAAGGGTTTTCCTTAGTGTTGGGTAACCTTCCTTGGATGTCTGAGTGAGCTTTGGTA
CATCTGTTAGTTTGGAAAGTGACTTGATCAAAGCCTTTATGTTACAAGCTCTGGTTTATA
GTTTGGTGTTGGAAGTTACAACATATGATTCTCTTTTCAGGTGTGATCCTGAGAGACTCG
CATGGTGTTGCTCAAGTACGTTTTGTGACAGGCAATAAAATCTTGAGAATCCTTAAGTCT
AAAGGACTTGCTCCTGATCTTCCGGAGAATCTCTATCATTTAATTAAGAAAGCGGTCGCT
GTTCGAAAGCATCTTGAGAGGAATAGAAAGGTAGGAGAATAAAACACACTACTAAATAAA
ACTAATTGCTTGTATTAACTTATTTCAGTAAAATGTAATACATCTGATTTCAATTATCTG
AGGTGGGCTAGGGTACAAACTAGTGAGCACTACAGCTGCTTTGAAATAAAAATTCTACCA
GAAGAGATTTTCTTTGGCTTTGGTGCCCCTAAATATAGTATATCCAGTTGGATGAAAATG
TTAAGAGTATGGGGGTGCTTTGGGTTTTGCTTTTTTTTTTTTTTGCAGAGTTTTGCAAGT
TGTTTCCTATTAAGTGTTACCTTGGAATCCTAAATAATCTGGCCACATGAACCCTAGTCT
TTGATTCTGTTACAGGGTGTTGGATAACTTTTCGTCATAGAAAGTGCGTGAAATCTCTAC
ATTCCTTTGTTAAACTAATGTTTGATAAAAATATTTAGTCATTTTGGGTGGTGTCTTGAA
TTGTGTTGTTATTTTTAGGATAAGGATGCTAAATTCCGTCTGATCTGATAGAGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTTTCTGCAAT
GGTAGGGGGTAGCAGCCACAGACAGCATAGTCAAATGGGTGTGGCTGTGCTCTATTGAAA
CTTTTAGACAAGCAGAGGGATGCAGTTTGCAGTACACTTGTTTAGACAATGAATGAACAA
GCCCCTTTGACTCCCTTTTAGGTAGTGGGTACTTTGATTTTCCACCTCTGCTCCCAGGTG
TTTGTAGTTTTTTAATTTTTGCTTGAAATGCTCACTATGATGATTGATTTCCAAACATTT
GCAGTTTCCACCAAAAGGTCTTTCCTTGTGTTGGCCAGTTCTTCCTTGGATGTTTGAGTG
AGCATCTTCATTATGCTTGAGCACAGTTTTCAGGAACTCAGTCGGGTTCATTATACATAG
TTGGGGATTATTTTAGCTGGTTAGAACTAATTCCATTAGAAGGGAGATTGTGTGAATGGA
CATGGAGGACCTGTATTAATCCCAATACTCTCTCTCCCTTTTTTCTTTGCAGTGAGTCAT
CCACAGCCTCTGCCCTGGTTGCATAAATTTGTCTATGAATTCAAACAATAAAATCATTCT
TTAACTAAAAGCATATTTTCTATTTTTCTGTAAAAATGTAGTATGTAAGTGGTACATATG
TGTGCATCTTTTTTGTAAAGTGTTTCAGCTCAGTTTCCAGTTTTATGATTCTTCAGTGTC
CATATATTGCATCTCTTGACTGACTCCTTAAACTAGTTGAGTAGCTTATAATCTCATAGG
TGGTTTCTAAGTATTTTTTATACATTTGATATTGATACTGAGATTTGTGACACATTAACC
CCAGTGTAGCTTCAAAAATCAAAAAGGAAGGTAAGACAGTCTTTGTTATGGAGGTGTATA
TATCAGGTCTTGCTGGTGAGGCTTAAAGATGAAGGATGGGTTGAGATGGCTCACACCTGT
AATCCTAGCACTCTTTTTTTTTTTTTTTTTGAGACGGAGCCTCAAGCTATCCCCCTGGGT
AGAGTGCCATGGCATCGCGCTCACAGCAACCTCCAACTCCTGGCTCAAGCGAGTCTCCTG
CCTCTGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGCTATTTTTTG
GTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1168..1216, 1529..1607, 2560..2729, 3198..3221, 3224..3297, 4012..4045
1001..1023, 1168..1216, 1529..1607, 2560..2729, 3198..3221, 3224..3297, 4012..4042
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved