Otolemur_garnettii Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii GNB2L1
Otolemur_garnettii
GNB2L1
GeneScaffold_5542
SNORD95, SNORD96
1333..1399, 2451..2526
6992
AGATCCAGGACTAGATCTGGTTCATAGCTAAGGATTTCAATGGCTAGGAAATGTAGTCA
ATGAGATTCCAGGCCCAGATCTCCAGGATCCAGGACCTTTAGGGTGTGTGTAAGGTGACC
AGATTTTAACATTGGTAAAGCGAGACACCATTGATGGGGACAGGGATGGGTTCTTAATTA
AAAATTTGGTCTATATGGAGCAACAAAAGTTTTCATAAAATACAAAAATAGTATTGTAAT
ATATATATTTTTAATTTCAACATAAGTACAATTTACAAATATAATATATTAAAAAAAATT
ATGTATAGGGCGGCGCCTGTGGCTCAAAGGAGTAGGGCACTGGTCCACCTGGGCGACCTT
GCCCAGGAGGGGAGTAGGGAGTTTACATTAGCCTTTTCATTCCCAAATGAAGTTACATTA
ACCTCTTCATTCCCAAATGGAGTTACATTAACCTTTTCAGCAGCCGAAAACCGTATATTC
CCTTCCCGTTGTGCTGCTGTTCCCTAGCTTGTTGTGCATTCTTTCCAAAAATCGGGACTT
TTTTTTAAAACGCCGTGGGACAAATTGTTAAAAATCCGGACTGTCCCGCCAAAACTGGGA
CATCTGGTCACCTTAATCTTTCCGAGAATGTAAGCTTCACCTCTTTTGCTCCTTCTACAT
CACGCTCTAAATCATCGTCTGAGGAGGATTTGTAAATACTCCAACGTACTCGTTTCGTAA
TGTATTTGTACAGTGCTACCAAATCATATTGCGTGGCGGAAGGGACCACAACGTCACGCA
GTCTCACCTGGCTCTTTGCACTAAGGGCGCCGCCATTTTGAGCAGAAGTGTATCATGGGA
ATCGCCATTTTACTTGGGCGGGCGGGTGTTTCCGGTTCCTGCGGGGGATCGCTCTTTCTT
TTTCTTCTTAGTACCTCGGCTGGAGTGGTCGTGGTGCTTGTCTCTTTGAGCTATCTGTTG
CCATCCTCGTCGCTGAGGCGACACTCGCACCCACCGCCACCATGACTGAGCAGATGACCC
TTCGTGGCACCCTCAAGGGCCACAATGGGTGGGTAACCCAGATCGCTACTACCCCGCAAT
TCCCGGACATGATACTGTCCGCCTCTCGAGGTACGGGCTAGGGTGCGGGACAGATTTGGG
AGGTAAGGGTTAACGCGTGTGTCGCGTGGCTGGGCCTGGAACGCGCGAGTTGGTGAATCA
CATTGCAGATGAGGACGCTGAGCCATAAATCAACCTGTAACTGCTGGGAGGATTAGAGAA
GTGGGGGCTTTTTTATTTATTTCTTGCCTGTCGTTCCGCAGATGTAACTGTGGGGGGACT
TGTGGGCCGGGCGGAGCGGTGATGACCCTAACATGCCATCTGATTGCCCGTGCTGAAATC
CAGAGGCTGTTTCTGAGCTGCCGCCCGGTTCTCAGCTTGGTGGGATGTGGGTGGACTTCA
TGGGGCCTCTGGACTCTCCTCTGGGCCTGCCCTTCCTACCCTCGGTTCTCTCATTCCCTG
TGTACCTGACTGCGTCTGGAGGTTTGCTTCCACACTATTTAAAATTGTCCGACACTGGGA
TCATGTCTGGCTCTTACTCATAAAACTGGAGTGTGGCACGTTTACTGTATCCAATCCTGT
AGTGCATAAAGTGACTTTTCTAGCATTAATTACTCGGTTTCTGTCACCCCTCAGAAGTAG
TCACAGGAGGCCCTCAAATAATTACTGAATTAGTCTGAGTCTTAGGAAAGAGTATCTATG
CTCTCTGGTACCTGAGTTAAATTCTCAGGGTATGGTTTAGCTCTACTTACGGTTTTATTC
TGGATAGTGAGTCACTCGGTCTTTGCCTAGTAACTGCTCTTGTAGCCTCCTGTTCCGGCT
CTCTTAGGGTCCTTAATTTGTTTTCTTTGTTGACCCATTCACTATGACCTTGACGTCCTC
ACTAACCTGGTAGGTTAGTTAATGGATTACAGGGTTCCTCATTTGTTTTCCTTTTGTGTT
TTACCTGTACGTAGATAAGACCATCATCATGTGGAAGCTGACCAGAGATGAGACTAACTA
TGGCATCCCGCAGCGTGCTCTCCGGGGCCACTCCCACTTTGTTAGTGATGTGGTCATCTC
CTCAGATGGCCAGTTTGCACTCTCAGGCTCCTGGGATGGAACCCTGCGCCTCTGGGACCT
CACAACGCAAGTAGCTGCTCATTTGTTCTGGGGAAGTGGGAGAAACCTGGGCAGAAAGGA
GGCAGATGGGGTGCCCAGGGGAAATGGGGTCTATCCCAGACTATGAAGCCAAAGCACCTA
CAGAAGGTAGGTGTGGCTGTTGGGTCTCCTTCCTTTTTCTAGTAACTCCTTATTTAGTGA
CTTGGAATTGTTGTGAGGAGCAGTCTGGTTGAACATTTTTGCCCAGATGCAGTAGTTTGA
AATGTTTTGAGAGTTCTGTTCTGGATGGGCAATTGGCAGGTGGAATAGAGGGTCCTGGTG
ATGACAGATGACATTGTCAGCCAACCCCCACGTGGGAGTGAGGACATGTCCTGCAATTCT
GAAGGGATTCTCTGGCATCCTAAGGGCTTGCTGTGATCAGAGTCACTTCCCTGGGTCTTA
TGAGTGATGCAGTGTGACTGGGACTAGGTCAGGAAAATGATCTTACAAGAAAGTGTTTGT
AAAGTCTGTCTGGAGAATGACCAGGTCCTTCTTCTCAGGGGCACCACCACAAGACGATTT
GTAGGCCATACAAAGGATGTGCTAAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTC
TCTGGATCCCGAGATAAAACCATTAAGTTGTGGAACACTTTGGGTGTGTGCAAATACACG
GTGCAGGTAAAGTGCAGCCATGGACAGAGGGCATGTGTTCAGGTTCTCTCTCCCCTTCCT
CCTTAATCTTTGCCTTAAGTGGGGATTTTAAGTCTTATCAGGAAATTAAAGAGATCTGTT
GACATCAGAGGGCTCTCACTTGGTGGGGTGAGGGGGTGGGGTGTGTTGTCTAGAGTTTCA
ATGGGCAGGACTATTTTCCCTTACTTTCTTTCCATTCTCTAGGATGAGAGCCACTCAGAG
TGGGTGTCTTGTGTCCGCTTCTCACCCAACAGCAGCAACCCTATCATTGTCTCTTGTGGC
TGGGACAAGCTGGTTAAGGTGAGCTTTGAGTCAGGGCGTGGGACCTTTACCAGCCAGAAT
GTGCTCCTATAGGCTCCAACTTGGAAGGCTTTGTAGATACCTTCAGTTCAACTTATTTCC
TCTTCTGTGTCTGAAGTAACTAATGTTCTCATAGGTCACCACACAGCTTTTGGTACTTAC
CTTAATCTCAGTTGTCCTTAAGTGGTCAAGGCAAGTTCTTTAACCTTTTTTTTTTTAGTT
ACATATGGGATGATAAACGGGTATTCAATCCAGGAATACTTTTTAAACAAGGTGCTGCAC
TTTTTTTGTTGGGCCCAAATCCTAGATCTGCCTGATCCAGAACTAGGCTCCTCACCTGTC
AACCCTCTCCATTCATGTAGGTGTGGAATCTGGCTAATTGCAAGCTGAAGACCAATCACA
TTGGCCACACCGGCTATCTGAACACAGTGACTGTTTCGCCAGATGGGTCCCTCTGTGCTT
CTGGAGGCAAGGTATTTTGGAGCCGGAAGTCTTCCTACTTAATAGGGTGTGGTATCATGA
GAAGAATACTTGTCTTTAGCTAACATAAGATAAAAAGACAGATTAATTGAAGAATTAGTC
GGGTTGATATAGGAGGATAATGAGATAGCAATCCAAGAATAGGTTCCTGATCATTGGTTT
CTGGAAATGACATAAAGTCATACTGTTTAAAAGAAAAAGACTGTTTTCTCTAAAGTTGTG
TTTCTTAGAGTAATTGACAGCCTCTCAAGAGTGTTAGGATTGCAGGCCCTGAGCCACCTA
GTTAACTGTGCTGGCTCTTGTAGGATTGGTGAGGTGTCCTGCATTAAAGGAAAGGCATAC
AGAAATAAATATTGGTCCTGGGATCATTAGCCTTCAAGAGGCTCGGGGTACAAAGAATGG
ATTCTGACAGAATTTTGAGATGGGTAGAATTGACATCTGGAAGAGGTTGTGCTGCCCTGA
CTCACCCTACCTGTCTGTCTAGGATGGCCAGGCCATGCTCTGGGACCTCAATGAAGGCAA
GCACCTTTATACGCTAGATGGTGGGGACATCATCAATGCCCTGTGCTTCAGCCCCAACCG
CTACTGGCTGTGTGCTGCTACGGGCCCCAGCATCAAGATTTGGGTGAGTGTGGGCTGTGT
TCAGACTGAGTGCCTGGTATACAGGGTGAGCCTAGGCAGTGTGTGGTCACTGGATGCCGT
CTTGGACTCCCAGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNACCTTTCCCCTGTGGGCAAATCAGCCTCTAGACTCTGAGTT
GTAGAAGGGCTTCAGAGAGAGACCTCTGTCCTGGGTAGAAGTGTGGTTAAGACTGTTTTT
TTTTTTTTTTTTATTTTTTTTATTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGT
AGAGTGCCGTGGCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCC
TGCCTCCGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGCTATTTTT
TGGTTGCAGCCCTCATTGTTGTTTTTGGCGGGTCCGGGCTGGGGATTCGAACCCGCCACC
TTAGGTGTACGTGGCTGGCGCCTTAGCCAGTTGAGCTATAGGCGCCGAGCCAAGACTGTT
TTTCCAGGGGGGGCGCCTATGACTCAAAGGAGTAGGGCGCTGGCCCCATATACCGGAGGT
GGTGGGTTCAAACCCAGCCCCAGACAAAAACTGCAAAAAAAAAGTGTTTTTCCATATTGC
CCTGTTCCCAGGACTTAGAGGGCAAGATCATTGTAGATGAGCTGAAGCAAGAAGTAATCA
GTACCAGCAGCAAGGCAGAGCCACCTCAGTGCACCTCTCTGGCATGGTCTGCTGATGGTC
AGGTAAGTGATCTGCTCTTTCATGACGCCAACTTTTGTCCCTCTTTGTGTCTTTGGTTTT
TGTTTTGAGATGGAGGCCTTTATCTGTTGTTAAAGCCTGGAGTTCAGTGATCTGATAATG
TAACCACCTACTCTTTGGGCTTAAGTGATCCTCCCACTTCAGCCTCCTAAGTATGTGGGG
CTACAGGTACTATGTCCCCCAGCTTGCCTCCCTCTCAACTGTTAGTGTGCCAGGCACAAG
AGCAATATATTTCATATAAAGTAAATGACAAGATTAGCCAGGTTGTAGTACGACCTAGTT
AACCATGTCAGTGTGTTTCTACCCCAGAGAGAAGGTTGTGATGTAGAGGGCAGTTGTTAT
CACCCTTCAGTTTATACCTTGATTCATTTGACCACTTTTTAAATGTCAGGATTCTCAACA
CTGGCTGTTTCTTCCTCTAGAAATATGTGATCACCATCTACAGCCTGGTAGTTAGAATTG
TGGGCTTCTTTCTTTTGAAGTGATGGGAGAAAAAGAAAGGCCTTTACTGACACTAGGGGA
ACTGCAGAATTCATGGCTGACCTATTACTGTCTTTTCTCTCCTGTAGACTCTGTTTGCTG
GCTACACGGACAACCTGGTGCGAGTGTGGCAGGTGACCATTGGTACTCGCTAGAAGTTAT
GGCACAAATAAAAAACTGGTTTGTCTGACTTCTGGAAAAATTTTTTTCTCCAATAAAGAG
GCTCCATCCTGTCTACATTGCTTACAGATTAAGAAGTTTAACATTGAGACACTGGCAGCC
TGGAAGTTAGGGGATGAAACTTGATGATAAAGTAAACAGGGCTTTGGGGTAAAAATGTCG
GTTTGTATGTACATTTTCTTAGGGTTTGGGTGCATTGGATGTGACATTATGGGAGGTCAG
TTTCCCAAACCTGCACTGTCCTACATTCCAGTACAATTGACCTACCTGAAGCTTAGGGAA
GCTTTTTTTTGAGATAGAACCTCAAGCTGTTGCCCTGGTTAGAGTGCTGTGGCATCACAG
CAACCTCTGACTCCAGGGCTCAAGTGATTCTCCTGCCTCTGCCTCCCAAGTAGCTGGGAC
CACAGGCACCTGGCACAAATGCCTGGCTACTTTCTTGGTTGCACCTATCATTTGGTGGAC
CCAGGTTGGATTTGAACCTGCCAGCTCAGGTGTATGCAGCTGGGGCCTTAGCTGCCTGAG
CCACAGGCACCGAGCCTAAAAGATGCAGAGCCTCAAGCTGTCACCCTAGGAAGAGTGCTG
TGACATCACGCTCAGCAACATCCAACTCCTGGGCTTAAGCAATTCTCTTGCCTCAGCCTC
CCAAATTGCTGGGACTACAGGCACCTGCCACAAAATAATTTTTTGGTTGCAACCATTGTA
GTTTGGCAGGCCTGGCTAGATTTGAACCCGCCAGCTCAGATATATGTGGCTGGCACCTTA
GCCGCTTCAGCCACAGGTGCCAGCCAGGGAAAGTTCTTGCATGAGAGGGACCATTTCAAC
ATGGTTGCAGTGAATTTAGGACTAGTAAGCTCCTGAAAATGTCCTGTAATTTCTTGGGGC
TTAGATCAAAATGGAGTAATATGGGATGTTTGGGGGGTAGGTTTTAATCTTCAAGGCAAG
CAAAGTCTAAGAAATGGTGCTTAATCACTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1994..2165, 2678..2825, 3042..3137, 3500..3610, 4102..4242, 5231..5341, 5927..5992
1001..1109, 1994..2165, 2678..2825, 3042..3137, 3500..3610, 4102..4242, 5231..5341, 5927..5989
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved