Otolemur_garnettii Locus ENSOGAG00000004239
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000004239
Otolemur_garnettii
ENSOGAG00000004239
GeneScaffold_3992
SNORA62
1382..1533
4482
GCCGCCGCGCTCCCCTTGGCTCCGCCCTTCCTCCGCGCAAGGCTGCGTATATAAGGACG
TCATTTCCGGCCGCTTGTCCTTTCCGCGCCGCTCAGGGAGGGCCCATACGGCGTTGTCCT
GGGTGAGTCCTGTTTGTGGTTCTCGGCGTTCTCTAAGACCACCAGGATGAGCTTCCTGAG
CCCTTGAGGGGTGCGGAGACTGGGGATGAAAGCAGGTCGGACCAGATGTGTCTGGGTTTG
GTGCGCGCCGCCTCATGCCGGCGCCCCGCACGTGGCTGGGTTCGGGCCTGCAGGTTCCCA
CAGTTCTCTGGGGGCGGGCGGAGGTCGCGCTCGAGTCGAGGCCCCAGGCTGGGCTTCCGG
TCTGCCGGGGGGCCGAAAGCGGGCTGAGCACACTGTCGTGTCCCTTCTGGACACCGGCTC
GTCCTGACAACGTTGAGGCTGAGGCGCCGATTGACTTGGACAGGGCCGGTTCGCGCCCTG
CTGAAGTGGAATTGCAGTTTTAGGGTTTTAAAGTACAGACATGAGTGACAGCACGGCGAA
GTAATTCCAGAGCGTTTGTCTACAGCGTGCTTGGAAATGTTCACATGTGCCCTACTTTTC
AATTCGCGTGTCCGCAAACATGGCTGCTCTGGCCGCTCATTTCTCATCTAGTTTTGCTCA
TCCATTAGCAACTGTGCTGTGCCTTGAGCCGTGTTGGATTTCATTTTGCTGTTTTTGTCT
GGTTGCATTACGCTGGGTTCTTGTACACTACTTTTCAAATACAAGATTTGCTTCAGTTCT
GTAATGTGGGGCCTGTGTCTGTTAACGTTCTGTTGTGTCTTTTTACTACCCTGCTAAGCT
TAGTGGCTGAGACAATAGAAGATGCAGTCTTCAGTTGCTTTTAAATATGAAGTGGACTTG
ACTTACAGTTAGAATGTATTCTTATTCCTACTTAATAACTGGAGTGAAAATAACAAACTG
TTTTCCAGATTCCCACCGTAACTTAAAGGGAAATTTTCACAATGTCCGGAGCCCTTGATG
TCCTGCAGATGAAGGAGGAGGATGTCCTCAAATTCCTTGCAGCAGGAACCCACTTAGGTG
GCACCAACCTTGACTCCAAATGGAACAGTACATCTATAAAAGGAAAAGTGATGGTCAGTC
ATTGCTTTAATCTTTTGTAATCTTAGCTGTAAGTACAGACATTAGCTAAGGCACTTCTTT
AGCTCAGAGACTGAGCCAGTGAAGGGTTTAAGCCTGGAGTGGCATGCTGTAAAGGAGTTT
TAGAATGAATTATTGCAGATGAAAAAGGGTGGCAAGAGTCCAGGTAGTGAATAAGAACTT
GTAGAGAGGCCCTGGTCCCAGGGCAAGGGAAAGGAAAAGTGGACTTTGCCAACTGAGTAG
GGGCTGCACACTATTAAATCTCAGAGTGATGTTCAGTCTCGGCCAGTGAACCTCTTGAGT
GTCGGAAGTGTGCTACATTAAAGGCAGGATTTTCGCTAACACCAGTAGAGCTTGCCTCTA
TGACTGGAGTTTGATAGTACTCTCTGCCACATATACTTAACATTTTAGAAGACTATCCAT
TTGCACAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGTTTGAGGTTGCTGTGAGGTGTGAGCTCAGCACTCACTCAGGTGA
CGTAAGAAGCAGAGACCATCTCGTGAGTACTGCTAACTCTAATTTAATTCTTCAAAGCGA
GCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTCCTATTGCAGGCCGCTTCACTCCT
GGAACCTTCACTAACCAGATCCAGGCAGCCTTCCGGGAACCTCGTCTTCTAGTGGTTACT
GATCCCAGGGCAGACCACCAACCTCTCACAGAGGCATCTTATGTTAACCTGCCTACCATT
GCTCTGTGTAACACAGATTCTCCTCTGCGTTACGTGGACATCGCCATCCCATGCAACAAC
AAGGTAATGAGTTTATGATTTAGTTTCCAAATAAGTCTCTAGGAAAAATAGCTATTCCTG
TGCACATTGTTAGAGCTTGGAGTTTAGGCCAATGGCCAATGAACTCACAAGTGTAGGTAG
TGTGCTACATGAGAGGCAAGTTTTTCGCTAACACCACAAGGGTCTCTGGCCCAATGAGTG
GAGTTTGATAGTAATCCTTGCTACAAGTATAATGTTAATGCATAACAACATTGAGAACGT
TGATGAAAACATCTGAAAATGGTCTGTTTTCTCCTGCCTTTCTCTGTATTTCTTGCTCTG
CTCTGGCATTACTTGGCTTTTCTGTTTTCAGAATAACTTGGTGAATCCTGCTATGAGATT
GTTAAAAGGTGGGTTGTGTGATTCAAATTGGTTCGTTTGTAACTGGCCTCAAAACCCTAG
TTGTACATAAAAATTGTCCAAAGACTGATTTTCAATGTCAATGTTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1096..1132, 2293..2411, 3237..3482
1001..1093, 1096..1132, 2293..2411, 3237..3482
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved