Otolemur_garnettii Locus SCRN3
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SCRN3
Otolemur_garnettii
SCRN3
GeneScaffold_4384
SNORA2
1956..2091
20822
TAAATTACACAGTATCTGCCTGTGTAAAGTCATTTTAAGATTTGGGCATAATTAAATAA
AGGAAAGAAGGAAACTGTAAAATACTGTGTCCATTTTGAAAGCTAAATAAAACATATAAA
ACACTCAGTGTTCTATGAGATTGTCTTAGCCAAAAATGGGATTATGGGATTAATCAGAAC
CTTGAAAAACTCTCTGCTTCTGCCCAGAGGCAGGATCCTGGTATATTGAGACAGGAGTCT
GCCAGTCTCTTCATTTGATGGCATTCTCTTTCTTTGTTCTCAAAAAAAAAAAAAAAAAAA
AAAAGAAGTAGAAGAAGAAAGAAACCTGTGAATTTAAGATTTTCCAAATTACAAATGAAA
ACATAATCTAGATGTTAAATTATACAATTAGTATTTTAAATTATATATGTGAATTTCCTC
TTGGAAATTCATATTTTTCAGAGTACAAAATGAGTCTGTTTCAAAATTTAGTCTTAAGTG
TCATGATCTGTGTGTATGCTTCCCCAGCTCAAAGGAGACCCTCCCTTCTTCCTTCCTTTG
AGGAAATTCTACTGGGTACACAAGACAAGATCCAGCAATGAGAATACAAAGATTAATAAT
CAGACATACTCCCAGCCCTCGAGGATCTCATTGTCCATATAGCAAAATATACACTTTACA
ACATTAGAGCTACATACAAGGATCCCCAGATATGCAAATAGTAAAAGGAAATTCAGGGAA
AGGAATTCAGGACAGAAAGGTCTTAGAGAATAAAATTGAACTATAGAAGAAGGTAGTTCT
CATTGCCATTTTCTTATTGATTCTTATAATACAAAATTGAGTCCCAAGTCATGTTATTTT
TATACTACAGCATATGAAATTTAAAACTTCAATGAACATCCTTAATTAGATATGGAAATG
ATATCTCTTGGTCATTGAGTAAAGCTCTTGGTTTTTAATATACTAAAAAATGCTTTCTCT
TTTTACTTTAAAACTTCTGCACAATTTTTAGCTTAAAAGTAATGGAACCTTTTTCCTGTG
ACACGTTCGTGGCATTGCCTCCAACAACAGTTGATAACAGGATTATTTTTGGAAAAAATT
CAGATAGACTCTGTGATGAAGTGCAAGAGGTAGTTTACTTTCCTGCTGCAGTTCATGATA
ACCTGGAAAAACATCTTAAGGTAAGTGAAAAACATGTTTTGTTAGGAATATACTTTTTAA
AGAAATATCGTAAACATTGTTTCTGTCAGCAATTTGGCAGAGACTACTGACATTAAAATT
CAAGAATTTAAATTTGAAAAATAATTTGAGTTAGAAATAAACTTTTTTGATCTTTTATTT
TAAATGAATTGGAGGAAGTTGAAAGAACAATAATAAAAAGTGTTCATTCTTGGATCAAAT
ATTTGAATACAAGCATGATAGAGCAAGGGATTTAAAGTCACCTGTTAAGACTTGATCTTC
CAGGAGCTTAGACTCTTGGACTAGGACAATGTATCCTAGGGATTAGGATATCCCGAGGGA
TTGTTAGGGATTTCTGTCCTGAATTTGTTATAAAGTAGGATGGTTTAAATACTAAATTTA
AGTAAGAGCAGCACGCTATAGCAACAGAGAAGGAACATTTAATTCAAACTGGGGATTAAG
GAAGGCTTCGTGGGAATTGGGGTTAGCTTAGCTAGAGTTTGATGGACAAAAAGGATTCTG
ATTCTTAATTGGTATAGGTGCTGATGTAGAATAGGAAAGTCATTCCAGACTCTGGGAATA
AGAATTTTATGACACATCAAAAAGGTTTATTAGGCCCTGTGATAACTATCAAATTCATTT
TATGCAATCACTTGGTACTCTACACATTAATTAAAGAATCTTAAAAATTAATTTAAACAA
CCCATTTAACATGAAACTTAAAGTGAGAGTTTGTTGCTAGTTAATGCTTTCAGATTTATG
TTGTTGATGTTCTAATATTAAAATATATGAATATTGTTGGCCCTGAATCAAGGTCCCCAG
TTTGCTGAAGCTGTTGATTTCAAGCAGGCGCCTAAAGAATTATCTTTCTATGGTCAGAGG
CTATTTCAGAACTTTGAAAATGTAATGGTCAATTCATTAGAAAGAAACGGTATGAGTCAT
TGGTGATAGATGTAGGCTAGTTTGTATTTGTAGTCTTAATACTGGGGTTCCAAAATATCT
ATAAAATATTATTATATTTATCTCAAGAGGATAATTAAGTTATTTGTTAGAATTATAGTG
CTGTTAAATCTTAATTACAGCCCCCCAAAATTACTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCATTTAAGTACCCATGTAAGTGATGGGTACTTACATCACTAATGT
ACATTGCTGGACATTGCTGTTGGGAACTGCTTCCTGAACAACAAAAATGTTTCAGGATGT
CACAACTAGAAACCGTCTCTCTCTTGAGCTTCTTTATCACTCTGTCTTTATGTCATTTCA
TGGCCCTTATACTTTATATTTTGTTGTATCTTAGTTAATGTGTACAAGTCTTAGTTTCTT
GAAAGCAAGATCTGTATGGATTCATCTCTGCAACTAACATATCTCTTGACTGAGTACTTT
ATAATAGATGCTCTGCAAAGCACCAATTCTCAATAGTTTAAGGATAACACCTTTACTAGT
GAAAATTTGTATTAAGTTATATTTCACTTACCTCTTTCATGATGACTGTGTCTTCTCATT
GATTTGTCAAATTCTGGATTTTGATAACTTTTATGCTTTTGTGGTTCTTGCAGTGACTTT
TTTTTTTTTTAACAGTGTACTTACATAGAAATTGAACAAGTTCCTGAAACATATGCTGTT
GTCCTTAGTCGCCCAGCATGGTTGTGGGGAGCAGAAATGGGAGCCAATGAGCATGGAGTT
TGCATTGGGAATGAAGCTGTATGGGGAAGAGAAAAAGTCTGTGATGAAGACGCACTACTG
GGGATGGACCTTGTCAGGTTATTTTTGTTATGTTTTGTTCTATAGAACTTGTCTAAATTT
TAAATTTTGATGTAACTCCTCTTACCCGTTTTGTTATTTTTTCTTTGTCTTTTTTTTTTT
TTTTTACTCTGATCCCTTAAACTTTGTGTCAGAAATGCCTCAGAGTACCACCATGCAGTT
TCGTGACTGTTAGTTATTATTAATTAGGAAAAGGGAAGGAGCTGGAAATGCTGATTCATT
GAAGTACCCAATGTACTTTATCATACTTTAGCTAATTCGCACAATAACTTCATGAGTTAT
TATGCTTATTTTACAAATCAGACACCTGAGGTTCAGAGATTAAGTAATTTGCCAATAAGT
TACCAAATTGGAATTTGCACGTAGATCTGTCTGACTCTGGAAACTTTGTTTTCATGATTC
TAAACTGACTTCAGGAGGAAAAGTTTAAAAGTTAGATTTGACTTTACCTGTCAACTTGAA
AGAATTTTTACCCTGAATATAAATGCTAAATCTCATGAGCATGAAATTAGTTAAGAAAAA
TAATAGAAATGTATTTTAATCCGAGAACTTTAATATTTTATTTTAGACTTGGCCTTGAAA
GAGCTGATACAGCTGAAAAAGCCCTCAATGTCATTGTTGATTTATTAGAAAAATATGGCC
AGGGTGGAAATTGTACAGAGGGTGGGATGATTTTCACCTATCACAACAGTTTCCTGATAG
CTGATAGGAATGAAGCCTGGATTCTGGAGACTGCAGGGAAGTACTGGGCAGCAGAGAAAG
TGCAAGGTATGGACAACTTTTCATGATTTGCTTTACAGTTCATAAAATATGCCCTTAATT
GCAGATATTGGATTTAATTGTCAAGATTGATAATCTAATGCAGTAACTGTGGGAGAAATT
TAAAAAGTTGAAAGGACAGTGAAAAAGCACTATAAGGAGCTTTCTTGAAAAGATATAAAA
GGAACATTAGTTTTGGGAATATGAATTTCAGATGACCAGCGTATACTTTCTTTACAAGAG
CTTTTTGCTGTTTCATAGTATTTTTTCACTTTTTAATAAACCCTAACCATTTCTTCCTTT
TTTAACTTTGACTTGTTCTCTAAAATCGTATTGTGTTTAAGAGTAAAGGGGAGGAAATAG
AAGTGGGGTTAAGAACAGGTTTTTGGGGGTTGGTAGTTAGGATATGTTGATAAAATAGTA
AAACATAAAAATTTGACATCATTGAACAACGCAGTTTTGTTTTAGAATGCTTTGGTTTTT
CTTTCCCCTGTTTTCTTTGTGATCATATATTCCTCTAATTTTTCAAATGATGGCTCGGCA
CCCGTAGCTCTGTGAGTAGGGTGCTGGTCACATACACTGAAGCTGGCGGGTCTGAGCCCG
GCCTGGGCCAGCAAAAACAATAATGACAACTGCAACCAAAAAATAGCCAGATGTTGTGGT
GGGCGCCTATAGTCCCAGCAACTTGGGAGGCTGAGGCAAGAGAATTGCCTAAGCCCAAGA
CACCACAGCACTCTATCAAGGGTGACATAGTGAGACTCTGTCTCAAAAAATATGTATATA
ATAATTTTTCAAGTGAATGAAAGACTTGAAAGTTAAATCTTCCCATTCTGGTTCTCAGCT
TAGTGTTCCTTTACTAGAACACAGCCTCGTGTTCAAGTATGATCATATACTTCTTACCTG
CAAGTTGTTTTAATGGACGTTTTATGTTTTGCTTTATGTTTTATGTTTATATAAAATAGA
ACTTAGACTGTTTTTACTATTATGGTAATTGGCCTGATTATGTCATTGAGCACTTTTTAT
TTATTAAATGTGCTACATGCAAGAGAGAAATGAACAAATACATTCTCTTGAAAGAGCTCC
ACATGGATATCCAAAATGAACACTTTCATTATTGGGTCTGATTATCTAGGTGTAGATTAA
CTTTGTTATCTGGTTTCTCTGTCTAGTATTAAATGTGCCCAGGAACTAAATTGTTAGACT
GTAAGGAATCAACTATTAGATAGAAAAATTTTCTTTTGTCTTTGATTGTTTCATGACACA
AATCTGGGTTTGGTAGTGAGAATATCCCAAGTATGACTTCATTAGAGTAATTTAATTGAT
TTGCACTTGGCAAACTATCATTTTAATTGATTTTAAAACATCAATTTTTATTTATCATGA
TCTGTTTTGTTTATTATAATTGCTTTAAAATGGTTTTTCTTGTTTTCCTATTTTGAATTT
TAGTTGAAATTTTTCTTTAGTGCCATAATATTTTTGGAAACCTTGTATTTCTGTTCTAGT
CTTATTTATGATTTTTTAGATAAATGTAATTCATAGGAAAGACTAATATTTAGAGTACAT
AAATAAGACTCAAAACTCGACAGTAAAATAAAATCCAGTTAGAAAATAGGCAAACGATAT
GAAGAAATATTTAACTCAAAGGGATATACAGATGTCAAATAAGCACATGAAATGATGTTC
AGTGTCAGTAGCCATTAGAAATGCAAACTAAAGCACCAATGAGATCTCATTATACCTCTG
GTCAGAATAATTAAAATAAAAATAAGTAAGTATAAACAGCAAATAAAATTAAAAAAAATA
TTACTAAACGTGGGCAAGAATGTGAAGACTGGTTCATCTATACATTGCTAGTAAGAATGT
GCAGCCAGTAACTCTGGAAGATAATTTGTCAGTCTTTCTAAAAATTGCAATTATGGCTCG
GCACCCGTGGCTCAGTGGGTAGGGTGCCGGCCACATACACCAAGGCTGGCGGGTTCAAAC
CCAGCCTGGACCAGCTAAAACAACAAAGACAACTGCAACAACAAAAAAATATCCAGCCAT
TGTGGCAGGTACTGTAGTACCAGCTACTTGGGAGGCTGAGGCAAGAGAATTACTTAAGCC
CAGGAATTTGAGGTTGCTGTGAGCTGTGATGCCACAGCACTCTACCCAGGGTGACAGCTT
GAGACTCTATCTCAAAAAAATAAAAAAATAAAAATAGGGCAGTGCCTGTGGCTCAGTGGG
TAAAGTGCCAGCCCCATATACCGAGGGTGGCGGGTTCAAACCCAGCCCCAGCCAAACTGC
AACAAAAAAATAGCTGGGCCAACTTGTGGTGGGTGCCTGTAGTCCCAGCTGCTCGGGAGA
CTGAGGCAAGAGAATTGCCTAAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATTCCAC
AGCACTCTACCAAGGGTGATAAAGTGAGACTCTGTCTCTTAAAAAAATAAAATACATAAA
ATAAATAAAAACTGCAATTACTGTATGATCTAGCAACATGTATTATGCTTATTGCAGAGA
AATAAAAAAAACTGACATGTATTTATGCAGAATTCATCCACAAATATTTAGGTTCCACCA
TCTTTCCCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCACATGGTAAAAAAGAGTTTGATTTTGCTGCAACATACTCTTACCTTGACACAGCCAAG
ATGATGACTTCATCAGGAAGATACTGTGAGGGCTACAAGCTTCTCAATAAACACACAGGT
AATTTTATCATTTAAATAATATCAGAAGACAGATTACATTTTATGTAGATATAATGTGGG
AATGATAAAATTTGTTTTAAGGAATTATACTTAGTAAACATACAGTTTTATTAAAACTGG
AAATACTGTGCTATTTATAGTGATATTTATCATAAGCTATTTCTTGAGGTAAGTGATGTA
TTATACAATTGTGAGAGGGTAATGATTCTTTTTTATTTATTTATTTTTTAATTCATCCAA
CAAGAAGCCAGAACTTTATTAATGATAGAAACAGTACAAATTTCAAACCAAACTGCAGTT
ACTCTTTTGAAACACCAAAAAAGTCCTCATTTTTTTGATGGTTACATTGTTATTTCCATA
ATAGCATTTACAATATCATTACTGTTGTTCTTCAGAGCTCGGACTGCCTTTGCTCTGGAC
AAGTTTGCTTGTGACATGACCAATTCTATGTCCTTAACTTCCACACCTGTCTCATCAGCC
TCTTCCTCCTCATTCTCTTCTTGTACAGTTGGAGTCTGTGTGTTTTCTTGAATGTTTGAT
ACCGCTTCACCTTGAACTTTGAATTTCTCAGCAGCTGCTGGCTGTGCCTGCTGAGATAAA
TCCTCGATCTTGGCTTCACCAAAAACTATATAGGTATCTGAAGCTGGGCTCTTATAGACA
TCTGGTTTTGTGATGACAAAGAGGATGTTCTTAGATTTCCAGATAGTGACTCTAGTAACC
CCTGTAACTTGTCGAAGACCCAGTTTGGACATAGTCTTCCGTGCCTTCTTTTCATTCTGA
CTGTTTTGCTTTACTGACTGGTTCTTCATAGATTTCAGCTGCCGCTGCCAGCTGCGCTTG
CTGTGTGGTTGCCTGTGTGGAATCTTGTTCCTCTAGCTCTGTACTGATTCATTACTGTCA
GATTCTGTTCCAGACCCTGTTTCAGCCTGAGGCTGTGGCAGCTCCTGCTCCGTAGCAGGG
ACGGTTTCTGTGGCTTCACCAGGCATGTTGTGCAGGGAACGCGGAACCAAGATGGCAGCA
GAAAGAGCTTTTTTATTTATTTATTGAGATAGAATCTCACTGTGTTGCCCTCAGTAGAGT
GCTATGGCATCACAGCTCATAGTAACCTCAAAGTCTTAGGCCCAACTGATCCTCTTACCT
CAGCTTCCCAAGTAGCTGGGATTAGAGATCCCACCATAATGCCCAGCTATTTTTAGAGAC
AGGGTCTCACTCTTGCTCAGGCTGGTCTCGAACTCCTAAGTTCAAGCAATCCAACCATCT
CAGCCTCTCAGAGTGTTAATATTATAGGCGTGAGCCACTATGCCCATTCAGTAATGATTC
TTTTTAAGGTCAAGTTCAGATTCTCAATTCTCAGAACCTTTTTGAACAAATCTCCTGTTA
ATATTCTTTTCTTTTCTTTTTTTTTTTTTGAGACAGAGTCTCCTTATGTCACCCTCAGTA
GAGTGCTTTGGTATCACAGCTCACAGCAACCTCAAACTCTTGGGCTTAAGTGAGTCTCTT
GCCTCAGCCTCCCAAGTAGCTGGGACTACAAGTGCCTGCCACAACACCCAGTCATTTTTT
GTTGTTGTAGTTATTGTTGTTGTTTAGCTGGCTCAGGCTGGGTTTGAATCCACCAGCCTG
GGTGTATGTGGCCGGCGCCCTAACCACTGTGTACAGATGCTGAGCCTCCTGCTAATATTC
TTAAAATAAAATTGGGATCACTTTTCTTCTCAGAATTAATTGGAACATGGAGACAGGCTT
CTTTGACTCTTGCTGCTGCTTTTATTCTCTCTTGATAATACTCTTATTGGTTATTTAATT
ATTACAAAAGTTGTCTCTAGAACTTCCACCCAAGAAGACAAACTGGGCTCAGTGCCCGTA
GCTCAGCAGTTAGGGCACCAGCCACAAACACGGAGGCTGTTGGGTTCAAACCCGGCCTGG
GTCTGCTAAACAATGACAACTGCAACAACAGAAAAAAAAAACCAGGCGTTTTGTCAGGTG
CCTGTAGTCCCAGCTATTTGGGAGACTGAGGCAAGAAAATTGCTTAAGCCCAAGAGTTAG
AGGTTGCTGTGAGCTGTGAGCCACAGCACTCTACCAAGGGCAACATAATGAGACTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGTCCTTGTTGACTACC
CAAGGGATTATACACACCAGTCATGTACAGAAATGGTCACATTAAGAGATATTGCCCTAG
TACAATGTGATGCATGTCTGGTCTATGAAAGTTGGGTCAACTCAAGGAGATGGTCAACGT
GGGCAGGTGGTCAACTATGGAGGTTCTGTTGTAGTTGTTTTAGCATTCTTGCCTGTTAAC
TCCATCATCTCTATAATTTCTAGGTCTTTTCTTGTTGACTTAATTTTTCTTTTGGTTTTG
GTTTGCATTTTCCTGCTTTTTCATATGCCTGGTAATCTTTGGTTGAATGATGGGCATTGT
GATTTCATTTGTTGAATGCTGAATTTAGTTATATATCTTTAAAGTGTTGGACTTTGTTTT
AGCAGTTAAGTTACTTACAGAACAGTTTCATCCCTTTTGAGCCTGTTTTTAAGCTTTTCT
AGCTCTAGAGTAAACGTTACTCTAGGGCTAGTTTAACTAAGGCATGTAATCCCACTGGGA
CCTCCACTGAATGCCCTGTGTGCTAAATAAGGTCTTCCTGCTCTAGATGTTTGGAAATTG
AAACATTCTCGGCCTAATGTTAAGCTTTATGAACTTTTAAAAACTTAAAATTTCTCTTTC
TGTAAAATTTGTTTGGTCTTATGGAGTTTCACCCTATGTGTGTATGCCAGTTGCTGTTCT
GCCGAAAGGTCACAGGAACCACTATACAGATTTTGAGATTTGGGGCAGTTTTTTAACCCA
GAATTTGACTCTTTGACTCTTTCCTTTATGGGATTTACCCCTTCACTTCCCACTGCCAGA
AGAAACAAGGTTTTTACTGCTGCTTGCACAAAATTTCACAACATTGACTAAAGCCTTTTC
TCAGGCTAGGGAGAAACTCACTGTCACCTCTCCTCCAGGATTTTTCTGTTTATTTATTTA
CAACTATAAAGAGCCTTCAGGTAGCTGTTTTTCTGTATTTTATCCTGAGGCAATAGTTAT
CTAAGGGAGGGTTGGCCTGATTGGGGCTTACTTTGTCACACTGAAAGTGGAACTCCTTGG
CCAGGCGTTGTGGGGGGCGCCTGTAGTCCCAGCTACTTGAGAGGCTGAGGCAGGAGACTC
GCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCGTGATGCCATGGCACTCTACCCACGGG
GCTAGCTTGAGGCTCCGTCTCAAAAAAAAAAAAAAGAAAGTGGAACTCCTTCCCATGTAA
CTTAATGTTCTATGCCATTATTTTACTTCTAAAAATATATACATTCACGTGATTCAAAAT
TCTAAGGTATGTAAGAGTATGCACGTATAATGAAGTCTCTCTCTCCTACCTGTCCCAAGA
TATTCAGTTCTTTTTCCCACAGGCAATTCCTTATGTATTCTTCCAGAGAGAATATATTTA
AAGAAACAAATATGGGCTTGGTGCCCATAGTTTAGTGGTTAGGGCGCCGGCTACATACAC
TGGGGCTGGCCCCAGGCCTGCTAAACAACAATGACAACTACCGCAAAAAATAGCTGGGTG
TTGTGGCAGGCTCCTGTGGTGTCCCAGCTACCGGGGAGGCCAAGGCAAAAGAATCGGGTA
AGCCCAACAGTTTGAGGTTGCTGTGAGCTTTGACGCCATGGCACTCTACCGAGGGCGACA
TAGTGAAACTCTGTCTCAAAAAAAAAAAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCACTGAGCCTTTGCATATGTTATATATGTTTTAAAAACATTTATCAGT
TGTGGCAGTAGAACGAGTCTAATTGCAGTTGATACTAAGTTTGTTTATAGTCAATCTCTT
ACTTAATTTATACCAAGACCAGTAGCTTATGTTGTATATTATCAGGAGAGAAAGCTGTTC
AGATTTGCAAGACATCTCTATAGGCATACATATTCAATGGTTTTTAAATGTTTTGCCCTA
GGAAACATAACTTTTGAAACAATGATGGAAATTCTCTGTGACAAACCAAGTGGGATTAAT
ATGGAGGGTGAATTTCTGACCACTGCAAGCATGGTTTCTATTTTACCTCAAGACTCCACC
CTTCCTTGCATTCATTTCTTTACAGGAACTCCTGATCCTGAGAGGTAAACTCACAAAATA
CTGTAAAAAAGCCAGGGATCAGGGGATGGGTAGAATCATTAGTATGCTGGTGATCTTGTC
AGGCTAAATTTATGTTACACAAATAAGGCAATAATTTTTTGATAAATTTTCTGTTTAGGT
TTTAGTATGTGATTTCCATGTATGCACAACTATTCTAATTTTTTAAAGGAAGGAAATGTT
AATAGTTTCTTATATGCGGTTACCCTTACTCTTCTTTCCCACAGATATATTTAATATTGT
CGAGAAAATAAAGTAGACAGGTCTTCTTACTCAGATTTCAGATACTGCAAACATTAGATG
ATTAATAACAGTTAATAAAAAGGTCAAATGATGTACCAGATTTATTTATGCAGTTATATG
TAAAATACATAGGCCTGTATTATAAAATTTAAAATATTGTTAGTTCCAGCTATATAAAAA
GTCAGAGTTTTAGAGATTATCTTGATTTGTCATTAATATCTGTCACAAAACTTAATGCAT
GTTACATTTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGATGGAGGAAGCTGCAGTCTTCTGTGAGGGAGGCTGTGGCCCACAGTGTTGTGGG
GAGTTCCGCTGCAAAGTGTGGGAGACTTCAAGATGAGGGAGGCCCAGGAGCAAATGACAG
GATTAACTGGATAACATGGCAGAAGTGGCCAGGCTGGTTGACTTTTCTCTATGGCCTTTA
GCCCATTCTATTTTTTTTTTTTTTATTTTGAGACTGAGTCTCAAGCTGTTGCCCTGTGTA
GAGTGCTGAGGTGTCACAGTTCACAGCAACCTCAGACTCTTGGGCTTAACCGAATGTCTT
GCCTCAGCCTCCCAGGTAGCTGGGACTGTGGGCACCTGCCACAATGCCTGGCTATTTTTT
TTTTTTTTTGAGACAGATCCTTAAGCTGTCACCCTGGGTAGAGTACCGTGGCATCACAGC
TCACAGCAACCTCCAACTCCTAGGCTTAAGCAATTCTCCTGCCTCCACCTCCCAAGTAGC
TGGAACTACAGGCACCCGCTATAACGCCTGGCTATTTTTTTCTTTTTTTGGTTGCAGTAG
TCATTGTTGTTTGGTGGGCCCAGGCTGGATTTGAACCCACCAGCTCAGGTGTATGTGGCT
GGTACCTTAGCCACTTGAGCCACCGGCGCCAAGCCTGTCTGTTTTTATTTTTTTGTTGTT
GCAGTTGTCATTGTTTTCTTAGCAGACCCGGGCCAGGTTTGAACCTGCCAGCCCCGGTGT
ATGTGGCTGGTGCCCTTATCCACCGAGCTGTGGGCATTGCCCTAGCCCATTCTTTAAAAC
AGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNATAATTTCATATTGAAATTTATGTTAAGATTAGAATATTTGTTT
TATGGAATTCTACCCCCAAATGATTCAATTATTTTAAATTATGCTCACTTTATAATAACA
TTTTTCTTACATACTTTTTGTCTAGATAACCCTGTAAATAGATCATGGTAATTGATCAAC
AATGTAAAAATTGCTCTTCTCCGTAAGAGTTATGGACATTCTCCCTTCTTGAAACAAGAA
AGAAGTCAATGTCTTCTTTTAGTTGCTTTTTCCCTAGAACATTACTATTCTGTTTCTTTA
ATTTGATAATATATATATATTTTTTTTAAGAGAGAAGGGTGTCTTGCTTTGCCTCCCAGG
CTAGAGCGTAGTTGTGTGATCAATCATGGCTCGCTGCAGCCTTGAACTCTTGGGCTCAGC
GTCCCAAGTATTGTCCAAGTGCATTCTGCAAATGCACCAACTTGCCTGGCTAATTTTAAT
TTTTTTTGTAGGATAGGGGTCTTGCTATGTTGCCCAGACTGGTCTTGAACTCTTGACCTC
AAGTGATCCTCTGGCCTCAGCCTCCCAAAGTGCTAGAATTACAGGCACAAGCCACTGCGC
CTGACCAGAAGACCTCATATGATAAAAATATCTCAGCCTCAACCTTCAGCAAACTTCTCC
ATATATAATTAATGTCAGATTTTCAATTGTTCTATTGTCTGTACATTTCCTGCTTATAGA
CTAATCGTATATAATTGTTCTTATCTTTTTTACTAAAAATAATGATTTAGTGTTAGTTCA
ATCTAAAGCAATAGTTTTTCCCAAAGAATTTCATCCCTTCTGTATCTAAGATAGGAGGAG
CAAACCAGAGTAGAGATCAGGTGACATTCTTGTGTAGAGGTGGGGCTGTGATATTCAGTT
AAACTCATGTATTTGTTTATTTTGGTATTTAGGAAAAAGCCAAAACAATACTGGACAACA
TGAAGAAACTGGAGAAAGAGCTATTCAGAGAAATGGAATCAATCCTTCAAAACAAGCATC
TCGATGTGGATAAAATTGTTAATCTCTTTTCTCGGTGTACAAAAGATGAGATTAGAATTT
ATACATCAAATATTAGTTCTCCGTGATCATATTAATGGTTGGCAGTCTTCCTGAAAGTCA
GAATCTATCACTTTGACAAATAATACAAATCTAATTTATGCAAATCAGATTATTCTTTAT
TAGCAGTCAAATGATGTCTTGACTATTAAAATTGCACATAGTATTATTGAAATACTGAGA
AAACAACTTCGGAATTGGATACATATATCGTGGGATAGCCATGTGTCACTTCAGATGATA
GACATGCATTATTTTCTTTAGTCACAATAACTTTTTGTCCTAATAATTAAATACTCAATT
CTGCATAATGAAACATTGAAATTATCCATACATGTATATTTATTATAATTATGTAGTACT
CGCCAATCATTTTTCAATTACATCCAGAAAGGATATTTCTCTTCAGTAACAGAAAACATC
TCTCAAGTGGTGAGATTTTTGTGATTTAGGCAAATATTAATCAGCTCTAACAAGAAAATT
TTCTAGATTTACATGTTATCTTTATCATTATAGTATATTGATTCTGCAAATGCATTTTTA
TTAAATTCAAACATGTTCTTTGTCAAGGTTTGGCTTTCAGCTCTAATTATCTAGCATGTT
TTGGGCCATTGCCCTTAATGGCCTTTTTTTTATTTATCCCAGATTTAACATGAAGGTACA
GATGATTAGGTTACGTTGTTTGCATTTGTTAGGTGAAGTTCAAGTTGTAGTTGAGCCGTT
CACCAAGGGGGTGTGCAGCTATACCCTTACTTTGTACACTAATCTCTTCCTCTTCTCCTC
TTTCTTTTACTTCCTTCCAGTTCCCTCCACTTGAATTTAATTGTGTTTTTCTTCCGTGAG
GGCATGCAGATTATCGGTTAGCTTCATATTAGTTTTGTGGTACATTGGCTTCCTTTTCCA
CTTTTGGGCTACTTTTATTAAAAAGATCAAAAGTCCCCTCTTTTTATGGGCTGCAATAGT
ATATGCATACCACAGTGTATTAACCCATTCATGAGTTGATGGGAATGGCCTTTTATATGA
AAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1159, 2835..3016, 3586..3785, 7042..7257, 12661..12823, 18461..18635, 19652..19822
1001..1159, 2835..3016, 3586..3785, 7042..7257, 12661..12823, 18461..18635, 19652..19822
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved