Otolemur_garnettii Locus BAT1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii BAT1
Otolemur_garnettii
BAT1
GeneScaffold_5531
SNORD83
7903..7980
18141
GTTGTTCAGTGGTTGGAAAAAGTCTTCATATTTGAAAAGGAATTGCTGGCGCCCCCCCC
CCCCTTCCCACTATCATGGAGATTATGGTGCTTCAAAGACACACCATTTCCCTGTCAATC
TCAAACTCTAAAAGTAGTGGGGATTATAAATTTGTTCGATTTATATTTGGATTGACCCAT
TAGGTGAATCATATTGGTCTTTTTTTGCAAAGTGTATGTCAAATGCAGAATATATTTTTT
TGACCAAGGTATTTGAAACTCAGCTGGTTGCCTATGCTCAATGGTTAGAGCACTGGCCCC
ATGCAGTGGGGATGTGGAGTGGGTTCAAACCCAGCCTGGGCCTGCCTAACCAAAAAAAAA
GGCATTTGAAACTGTATGAAATTGGAGAAGGCGGGAGGCTAGGGTAGAGGGAAGCCAGGA
ACCGGAAGTGTCCCTCTTTCGTCGTTGTTGCTGCCGCCATACGCTCTCGCCCTACTTAGC
TCTTCTGTCAGAATCTAGTATATTTTCTTTTGCTGTCCCTCAAAGCCTCCCACTCCTTCT
CCCTTGTTTTTACCTATACTGGGAGAACCTGTCCAGAGCCCCCTCCCCTTCTCCCCTTGC
TGGCCCAGTTATGGCAGAGAATGATGTAGACAATGAGCTCTTGGACTATGAAGAGGATGA
GGTGGAGACAGCTGCTGGGGGAGATGGGGCTGAGGCCCCTGCCAAGAAGGATGTCAAGGG
CTCCTATGTCTCCATCCACAGCTCTGGCTTTCGCGATTTCCTGCTCAAGCCAGAGTTGCT
TCGGGCCATTGTGGACTGTGGCTTTGAGCATCCATCAGAAGTCCAGCATGAGTGCATCCC
TCAGTCCATTCTGGGAATGGATGTCCTGTGCCAGGCTAAGTCAGGCATGGGGAAGACAGC
GGTGTTTGTGCTGGCCACGCTGCAACAGCTGGAACCAGTTACTGGGCAGGTGTCTGTGCT
GGTGATGTGTCACACTCGGGAGCTGGCTTTTCAGATAGCAAAGAATATGAGCGCTTCTCT
AAATACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTGTTTTT
CTTGACAGCCTGATAGCTGTTGGGAATGTCTCCTACAGTAAGCATGGGGTTGATGATTTT
AGATCACAGAATTGAAGTTAGTTATCTGCCAGGTGTGCGTTTGTGGCAGACACTTCCTTA
GAGGGGATAACAAAGGGCTATTCTTATTACTGTATGTCTCCATCTGCTTCTGCCCAAGGT
GTCTGTGCTGGTGATGTGTCACACTCGGGAGCTGGCTTTTCAGATAAGCAAAGAATATGA
GCGCTTCTCTAAATACATGCCCAATGTCAAGGTAAGCCAAGGTAAAGTGATCTGACTGGG
AGAGTGAGTGTGTGGCAAATTGGAGGTATCAGAAACTAGTAGGTCAACAAACTCTATGTT
TATAGAGTTAATACATTGTTAATACATTAATTGCTACACTAAAGAAAAAATTGCCTTGGA
GCCATGGTGTCTTATTAAGAAAATAGAATAAAAACTTAAAAAAAATTTTAATGAAAAATT
TGTTGGTTTTTTTATTTAGCTCTTGGGTGTGCAGGCTGAAGCAGGGCAGTAGGAGGTGGG
GTGAAGTGCTGATTGACAGTGAAAATAATGAGCAGAGATTTCACAGCTTCTCAAGACCCT
GGGCTCAAAACTAACATGAGTTGGCTCGGGGCCTGTAACACAGTGGTTATGGCTCCAGCT
ACATGCACCAGGATTGGCAGGTTCAAAGCCGGCCCGGGCCAGCTAAACAACAATGACAAC
TGCAACAAAAAATTGCTGGGCATTGTGGCAGGTGCCTTATAGTCCCAGCTACTTGGGAGG
CTGAGACAAGAGAATCGCTTAAACCCAGAGCTCGAGGTTGCTGTGAGCTGTGACACAGAG
CACTCTACTGAAGGCCACATAGTGAGACTCTGTCTCTAAGAAGGAACAAGAGGATGAGTT
AAATCCAACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCATTCACTGTCTCAGCCTCCCAAGTAG
CTGGGACCACAGGCGCCCGCCACAGTGCCCAACTATTTTTTTTGGTTGCAGTCATTATTG
TTGTTTGGCGGGCCTGGGCTGGATTTGAACCTGCCACCTTAGGTGTATGTGGCTGGCGCC
TTAGCTGCTTGAGCCACAGGCGCCGAGCCGTGGTATGTGAATTTTGAGGATTCTTTTTTT
TTTTTTGAGACAGTTTCACTATATCACTTTCGGTAGAGTGCCGTGGTGTCACAGCTCACA
GCAACCTCAAACTCTGGGGCTTAAGTGATTTTCTTGCCTCAGCCTCCCAAGTAGCTGGGA
CTACAGGTGCTTACCACAATGCCTGGCTATTTTCGGTTGTACTTGACATTTTTGTTTGGC
AGGCCTGGGTTGAGTTCCAACCTGCCAGTTCTGGTGTATGTGGCTGGTGCCCTAGCTGCT
GAGCTATAGGTGCTGAGCCAATTTTGAGGATTCTTTAAAATGGCAGAAAATTAAAAGATG
TTTAGGGAATCAACAGCATAGCTTGAGTTGTTTTTCCATTATATAACCTTGATACTCATG
ATAGGGTTGCCAGACCAGTAGCCACAGCATCATTTGAAAAGTTGGTGGAAATGCAGATTG
TATGGGTCCTATGCCACACCTACTGGTCTGAATATCCATTATAAAAAGATCCCTATATTG
GAGTTTGAGAAGCACTGATGTATATAACATCCTGTGGCTAGTCTTTTTCTTTGGATGGTT
ATAATTTCTGCTTCAGTTTTTTTTTTTGAGACAGTCTCACTATGTTGCCCTCAGTAGAGT
GCCATGGCATCAGCTCACAGCAACCTCAAACTCTTGGGATTAAGTGATTCTCTTGACTCA
GCCTCCCGAGTAGCTGGGACTACAGGCGCCTGCCACAATACCTGGCTATTTTTTTGTAGT
TGTCTTGTTTAGCAGGCCTGGGCCAGGTTTGAACCCGCCAGCCTTGGTGTGTGTGGCTGA
GCTACTCATAACCACTGAGCTACGGGTGCCAAGCCTGCTTTAATTGTTTATTATTTTGTA
TTATTATTATTTTTTGAGACAGAGTCTCACTTTGTTGCCCTCAGTAGAGTGCTGTGGTAT
CACAGCTCACAGCAACCTCCAGCTCTTGGGTTTAGGTGATTTTTCTTGCCTCAGCCTCCC
GAATAGCCGGGACTACAGGTGCCTGCCACAACGCCTGGCCATTTTTTTTTTTTTTGCAGT
TTGGCTGGGGCCAGGCTGGAACCCACCACCCTCGGTATATGGGGCCAGTGCCATACCCAC
TGAGCCACAGGCGCCGCCTTATTTATTTATTTATTTTTTGAAATTTTTTAGAGACAGAGT
TTCACTTTGTCACCCTCCGTAGAGTTCTGGGGCATCACAGCTCACAGCAACCTCCAGCTC
TTGAACTTAGGCGATTCTCTTGCCTCAGCCTCTGAGTAGCTGGACTACAGGTGCCCCGCC
ACAGTGCCCAGCTATTTTTTGTTGCCATTTGGCTGGGGCCGGGTTTGAACCCGCTACCCT
CAGTATATGTGGCTGACACCCTATTCACTGAGCCATAGGCGCTTCCCATATTATTTTGTA
TTTTAAAGGAATCAGAAATGTTAGACTTGTAGTCCTAAACTGAAAGTAATTTCTTAAAAT
CCAAACTAGTAGTAGTTATGCATGGCAAAATGGTTAAATAATCTAGAGGGCCTAGTAATA
AAAAAATTTGTGTTCTCCCATCTCCAGTCTTGCTTCACAGAAAGTGATTATTTTTTAAAA
AATTCTAATGGTTTTATATTACCAAGTGTTAAGCACTGTTAGCTCAGTTTATCAACTTAA
TAGGCCTTTTGACTTTTCACAAAACAGCTTGTTTACACTATTCTTCCATCATTTGAAAAC
CATAGGGCATCCCAAAGGTTGCCATACATAGGGAAATAAAACTCACATTTTGTATTTTTT
AATATTTTTTATATTAACATGTAGACAAATACTTTGTAAAACTTCGTAGTGAATATTCTG
TAAATAAAGGTACGTTTAGCTATATTTCTCTGTGTATGTATGGTGACCTTTGGGTAAGGT
GACCAGACGTCCCGCTTTTGGTGGGACAGTCCTCATTTTTAACAATTTGTCTCGCATCCT
GCGGCATTTTAAAAAAGTCCCGATTTTTGGAGAGAATGCATGACAAGCTAGGGAACGCAG
GAGAACAGGTAGAGAATATACGGTTTTTGCCTGCCATGTGGCTATTTTGCCAGGATATGA
GTTCTGTATTATTTTTGTTAATTTTATAATGTTAAACTTTAATAATAACAAATAATTGTT
GAGAACTGATTACCGAGAACTGCTTATCAAAGTCTGCATTGTTGTTAGGCCCCACCCCTG
CAGGCCCCGCCCCCCTCCACCCCCATCCACGCCCATCAGTGATGTCCCGCTTTACTAATG
TTAAAATCTGGTCACCTTACCTTTGGGACACCCTGTATTTGAATTCTTTAAATATGATTT
GAAGGCCATATGTACCTGTGTGTTGATATTATTACATGTATCTCTGTTCTTACATGGTCA
GTGAATATCATCTGTAGGTTAATTCTAAAAGTTGAAAGCAAGGAAACAGTTTCCATTTTA
GATCTGTGGAAACATTTATTATTGTGCTTAATAGTGAGCTAAGTTGCATTCCTCCTATGT
AGGTCCAAGTCATCTCCTTTGTGCCACTCAAAAGAGAATGTTCTTGGTGTCAATATCAAA
TACAAGTTGTTATTACTTTTTCCTTAAACTTGCTCAAGATATGTTACAATGTTACGTGGA
AGAGGCTGGGCTAGTATAGAATATTCTTCTGTGGATTTGTCTGTCTTTTTTTTTTTTGAG
ATAGCGTCTCATTATGTCACCCTCAGTAGAGGGCGGTGGCATTCACAGCAACCTCAAACT
CTTGGGCTTAAGTGATCCTCTTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGTGCCCG
CCACAACACCTGGCTATTTTTTGGTTGCAGTTGTCATTGTTTAGCAGGCCCAGGGCTGGG
CTCGAACCTGAACCCATCAGCTTCGGTGTATTTGGCTGGTGCCCTATTCACTGGGTACAG
GCGCTGAGCCTGGATTTGTCTTCTTAATCTTTATCATATCATTTAGCTTGTCTTTTCTCC
CAGTGATTACTTTAAATTGAAATTGTATTTGAAAGTTGACTGATTCAGTCAAAACATTTT
TGGTGAGATCCTTCTAGGTGATACTGTACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACTCGCTTGAGCCCAGATTTGGAGG
TTGCTGTGAGCTGTGATGCCACAACACTCTACCCAGGGGGATAGCTTGAGGCTCTGTCTC
AAAAAAAGAGAAGGAATGAAGATAAATACATTTGGGAAAGAAATCAGATGATTGCTGCAA
CAAAATATTGAGCAACAGTGATAATAATGCAAAAAAAGTAACATTCACATTGTCAGATAA
ATATAACTATCATGGAATGCTTTAACTCTGAGATTCAGTATGGAGTCATCAGTTATAGCA
TTGGCATAATAGTTTTAACATGGAATAATATGTTTAGCTTGACTCAGTAATTTCACAGGA
TTTATGTGAAGGAGTTTAAGATTCTGGGGTTCAGGGCAGTGCTTGTGGCTCAAAGGAGTA
GGGCGCCAGCCCCATATACCAGAGGTGGAGGGTTCAAACCCGGCCCTGGCAAAAAAAAAT
GATTCTGGGGTTCAGTTAGGACAACTTGATGTTCCACATATTTCTTTCTGGTACTTGACA
CTCCTTTGGTGATTTCTTGCTGTCCTTATAATCAAGCCTGGCCTTATAAGTGAAGTGAAG
GAAGATGATGCGATTAAGTCAGAAGAATTGAACTCTAGTCCTGGCTGCCTCAAGTAGCCA
TCTAACTTTGGTCAAGTCACTTTTGTTTCTTAACCTCACTGTTTTAGAGGGAACAAGAAT
TTTAGATAAAGTGTTTTCTAGTTCTTTTACTTCTCAGGTGTCCTAAGAATAGCTTTAACT
CACACTGAAAATGGGAACTCTGGGGAGATTGGATTTTTTTTTTTTCTTCCTGTGAGACTC
TTTTTCCTGGCTTGGCAGGTGGCAGTATTTTTTGGTGGTCTCTCTATCAAGAAGGACGAA
GAGGTACTGAAGAAGAACTGCCCGCATATTGTCGTGGGGACTCCTGGCCGCATCCTAGCC
CTGGCTCGAAATAAGAGCCTTAACCTCAAACACATTAAACACTTCATTTTGGATGAATGT
GATAAGATGCTTGAACAGCTCGGTGAGTGACAGTGCTGGAACAATGTTAGTGGTCTGGGG
AGTTGCTTTGGAGCCAAATGATGCTTTTATCTGATACTGGAGCACTTCAGTGCAAAGAAG
ACTCTTATCTATCACCCATGACTGATGGCTCTGGAATCCCTAGTTGGTCTTTTGTTATGC
TTATAAGCAGCCTTGGTAATCAGAGAGGAGGGTGTCATTTGTCATCTTACTAACAATTTA
TGTTTTTTTTACCTTTGAGAGTAACTTTAATAATCCTAGATGTAGGTCACCATCACCACC
GTCTTTTTCTTTACAGATTCTTCATATACTGAGACTCATAGGGAAGATAATAAACTAGAG
AATACAACGTACCTTTTTGGCATCTCCAGCACAGGATATATGATCAGAATTTATAGTTGA
ATATATATACACAACGCGCACACATATATAGCAGAATTTATAGATTTTCAGATTTAGTTC
TGAGATTAATATGGAATGTTGGTGTATGTTTGTATAGTGTAATATGCTAGTGTGCCAAGT
GAGGTTAATAAAGGAGGTTTTTCTCTAAGAATTAAATCTTGGTGAATGAGAGTGGGGATG
GACATAGCCTGAGAAGTCATCCTTAATCGTCTTTGGTGATTCAATAGGGTGAGCTGTGAG
ATAGGATCCAGGTACGGATGGCATACTTGCCTGACTGGATAGGAAAGTGTGTTTCAGATG
AGACAGAGTGGACTGTAACATGTAGAGTATAATAAGTGTTCAGTTTTATAGACTGGTGGA
GGGTAGGGCCTGGGGGGAGGGCAGCTGGGAGGAGGGCCTTTAAAGCATTTTTAAAAAGCT
AGATTCTTGTGGCTCACACCTATAATCCTAGGTCTCTGGGTGGCTGAGGTGGGTAGATTG
AGCTCTCAGGTTCTAGACTAGCCTGAGCCAGAGTGAGATTTTGTCTCTAAAAATAGCTGG
GTGTTGTGGCAGGCACCTGTAGTCCCAGCAACTCTGGAGGCTAAGGCAACAGAACTGCCT
GAGCCCAAGAGTTTGAGGTTGCTTTAAGCTGTGACACCATGGAACTCTGCCAAGGGCAAC
AAAGTGAAACTCTGTCTCTAAAAACAAAAAAAAGCTTATATCCTTGTGAGCCTCTGCAGT
GGGCTTTATCTCCACTTTATAGTTGTGGGCTTTGATCATATTTCTTGCCTGGTTAAAAGA
TACAGCTAGAAGCTGATCCCAAATCTTTCCTCTAAATTCATTGTTCTTATTGTGTTATGA
CCATGAGTTTGATTTTGTACTGGTTGGAGAAGTTCCTAAAGTGATACCCTTGCTTACCCA
CTTCCAGTAGTCTTCACCTCATTGAGAGCTGTTGATAGCACATACTTATTTTCTCCTGTA
ATCTTTTTCTTTGTTCTTGTAGACATGCGTCGGGATGTCCAGGAAATTTTTCGCATGACC
CCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGAGATCCGTCCTGTC
TGCCGCAAGTTCATGCAAGATGTAAATAACCCTTCTACCTTCTCTCCCTCCACTCCCTGC
CCGCTGCCTCCTCCCCTTCCTCGCCCTCTTCCTCCAGAATCCCTTGTCCTTCAAGCACCA
AGAAGGGGGCTTGTGCCGCTGATCCGAGAATGATGACTCCTTGAAGAGACACACAGAAGC
AGAGACAGCTAGTGTTAGGGTCTGCGCGGGTGCCAGGGAAACTCCGGAAGACTTGGTCGG
GTTAATGTGAGAGCGGGTAGCGTTCAACTTTTTAAAAACTCACAGCATTTTTTTGAAACT
CTTCTCCCTTTTGGGGGAGGGCAGGATTTTCTGCCCTCTGACCCACCCATCGTCTCTTAC
ATCCCCTGTACAGCCACACACTCAAGGTGGCATCAAGCATACAGCTGGAGCCTTCTGCTC
ACCAAAACTCCTACTTCCCGGTAGCAGGAGAGCAAGAGAGGGACAGACAGATGGCAGGGC
ATGTCCAAAGAAGAGCAAACAGCACGAATGAATCCTCCTCCTGCCCACCTCCAGGGTGGG
GGCCTTTGGCACCTCAATCCCCAGTCCCCTACTCCTTCCTGCCCGTACCTCCTTGCACCT
ATCTGGAACCTCGGTTGATGTGAGCCAGCAACAAAGAAGCACCATGGCGCGGCGAGAGAA
TGTGAACGGCACCCAGCGGTGGATGGCGGCAGCGGAGGCCGCGGGGAAACCTGACCAGGA
AGCTGAGGACCAAACCAGCCTCTTTTTCTGTTCCCGGTTTTTTTCCTGAACCTGACGCGT
GCTGTGCCCCTTGTTTCCCCCATATGTGTTGGGGAGGGGTGTCCTGAATGGGTGGTGGAT
TTTTTTCCTTTGATTTTTTTTTTTTTTTTTTTTTTTGATACTCAGGAGAGGGATATGGGA
AAGGTGAAGTGGAAGTAATCAGGTTGGCATTAGGGTTTGGGACTAGGTGGGGCCCATTGT
ATAAGCAGTGGAGTGTGTTCCTTCCCTCCCTGCAGTATTCCTTCCCATGGGATGGGAACT
TTTTGAGCTGTACTTGGGGCTAGAGTTAGATTTGAAGGAGGCCATGGCACTTCTCTTTGG
AAAGCCTACCTTGCTAGCCTGAGTTCTGGGATGGAGCTTCTGGGGATATTTTATTTATAA
TGCTCCCCATGACATACACACATTCTTTCTTACCTTGATCCCTGGTCTCATATAACTCTG
TTTTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAAAAAAAAAAAACGGAAGGACTAGGCTTTCTGTGCCCGAATTGTT
TTTAAGCATCACTTCCGATCTTCCTCATAACCGTGGAGGTTGCATTCTACTCCAATGAAA
ATTATTGCTTTTCTATTATTGAGACAGAGCCTCAAGCTGTCCCCTGGGTAGAGTGCCGTG
GCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCT
CCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGCTATTTTTTTGGTTGCAGC
CGTCGTTGTTTTGGCGGGTCCGGGCTGGGGATTCGAGCCCGCCACCTTAGGTGTATGTGG
CTGGTGCCTTAGCCGGTTGAGCTATAGGCGCCGAGCCCCAGAGACCATTCTTATCTAAAG
CTATAGCTTATGGCCTGAGGGCAAGTTTTTACACATCCTAGGCAATTTTTGCTTCTTCTT
TAGTGGCATTTTGATAATGTCCATTGTAGCACTGTGATCTTGAACATGTGCACTTTCCTG
AAGTGCATAAAATATTCCTAGTAAAACTAGAATGGATCAATCCTTGTTGTCTTCCCCATG
TTCTTTAAATCAACTCTGTTGGAGTTACTCTGACCTTGAGTCACTGTTTCCCATCATTTC
TCAGGTGTTTGGAAATGGTCTCTTTGAGAATCATCTCCCATTTTCTTTCCTCCACCACCT
CACTTTGAGCCTACTAAGCATCTTGCCGTAGGGTGGTTTCAGTGCTCCTTACCCTCTATG
TGAAGAGTTTTTTCCCATAACAGTTTCTAGTTGGGCATTCTTAAAATTCAAGTAGGAAGG
ACATTAGATCTAATATGAAAGAGACCACAGTGAAATGTGGGTGTTTTTGGGGGTGAGGTG
GGATTTTCAATCTTCTCTCTTCTCCCCATCCCCCTATGGGGTGTATTGGAGATCAACTTC
CTCCACCCCCCCAGGTTTAACCCCCCCACTCTGCCCTCCCGTTCCCTACTCCCTTCCTCC
CCCCCAGCCAATGGAGATCTTCGTGGATGATGAGACGAAGTTGACGCTGCATGGATTGCA
GCAGTACTACGTGAAACTGAAGGACAACGAGAAGAACCGGAAACTTTTTGACCTTCTGGA
TGTCCTTGAGTTCAACCAGGTCAGTTGTTGAAGGTCCACTAGGGATCATCGTTGGATACA
TGTCCTGCTATAGCAGATACCTATTTATTAAGTACTCTTACTGAGGAGACCACATGTGAT
GTAGGAGAATGATGATTGTATGAGTGTCTTTAGGGGCTGAGTTTGACCAAGGGTGGGAAC
TGCTTTTCTTTTCTATGGCTAGCAGGGATAGATCTTGAGTAAATAAAAACCTCAAGGAAA
ATATCAAATCTTTAAAGGGTTTTAGTGAGTTTGTAAAAATCTTGAAGTATTTTGGATGTG
TTAGGGTTTGTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTATCCCCCTGGGTAGAGTGC
AGTGGCATCACAGCTCACAGCAACCTCTAACTTCTGGGCTCAATTGAGTCTCCTGCCTCT
GCCTTCCAAGTAGCTGGGACCACAGGCGCCCACCACAATGCCAGGCTATTTTTTGGTTGC
AGCCATCATTGTTGTTTGGCGGGTCCGGGCTGGATTCGAACCTGCCACCTTAGGTGTATG
TGGCTGGTGCCTTAGCCACTTGAGCCACAGGCGCTGAGCCTGTGTTAGGCTTCTTAAATC
TGTTCTAGTACTAAGGGAAGCATTTTTTTTTTTTTTTGTCATTTAAAATTTTAGTAGCCA
TGTAAGAGAAAATAAAAAGAAATGTGAGATTGAGTGTAATAATTTAACTCAAATATGCAA
AATATTTTTATTTCAGGATGTTATCAATATAATATTATTGTAGTTTCTCATTTTGGTACT
AAATCTTTCAAAGTCATTCTATGTTTTAAGCTTCCAGCACATCCCAGTTCAGACCAGCTT
ATTGCAGATGCTCAGTAGCCACCCATGGTCAGTGGCTGACTTATCTGAAGTTTACCTGTG
AGGGTTCTGACACTTCTGATCTCAGGGAGGTGAGAGCCTGAACCCACCTTTTCTGCCAGA
GAATGGAACACCCTCTTCCTGCCAAACTTTATTCTCAGGCCAAGGGTGAGAGAGGCACAG
TGCCCAGATAGATAGGCTTCAGGGGACTCTTAAGAAGAAAGTGTCCATAGGCAGACAGAG
GCATATTCCCCTTCCAAAGATGATACAGTAAATGAAGAACCTGGGGCCCCAGGCAGAGGG
AACAGATGGTTTTATATTTGTCCACATCTTTGACCTCCAGAGTTTAGGTGTGGAGGGAAT
AGATTAAAGGGAAATTTATGTTGCAATTTGGCCTTGTCCCTGATAGGCTGTGATTACCGG
TTTACTCTTCTGTAGGGTCTGTATGTGTTAAAGGCATACGTGTATAAATACACTTCTGTA
TAACTTAACCCAGGCATCCATGTATAAATGCACTTCTGTATAACTTAACACTGTCTAATA
AGAGGTCTAACTTTAAATGTGGAGAAATTAAAATCAGTACCTATAGGGTCCCTTCTGTTT
GTCACTTATGTGGTAATCATCATCAAATCCTGGGTTCTACCTACACTGGGTGTATATATT
AGTTAGCTACTATTACATAACAAACTACCCTAAAAGTTATTAGCTTGTGATTGAGCAAAT
CAGCAGTTTAGGCTGAGATCAGCTGAGTCTTTTTCTGGTCTCAGCTGGACTCTTCCGGGA
ATGTGTGGTTTAGCTGGTGATTGACTAGGCAGCTGTGCATCTGGCTGTTGACCGAGCACT
TTGAGTATCCTTTCCATGGGATCTCATCCTCCCAACAAGTTAACATTAACTTGTTCTCAT
GGAGGTAGCTGGGTTCCACACTTTCTCAGTCTCTTTTCTTTATATTTAAATTCCTAGGGC
CACAGCTTCCATGTCTTCTCCAGTACCAATTTTTCAAATAAAATATTTATGCTCTTCCCT
GGTGGATGGTCTTGTGTGTAATGAGAAGTCTCTGGTTTCCTTGTTTTCTAGGGCTCTTTG
AAGACAAGTGATCAGTTTCAGGGAGACCAGGTTTTTGTAATTCTCTAATATAACTTCCCT
AAACAGATTCTGTGAGTAGGATCTAGGCATGGCCACTCTTCAAGAGAAAATTCCATGGTC
ACATCTTTGAATGGCAACAGTCCCAGTTCCCAGATTTCTGGGGTCTCCTGCCACCCTCCA
CCCAGATCTTTCGGTAACTCTTAAGAGAAGCATTTCATCTATATACCTGTTACCTGTTGT
GTGGTCTCTTTGTATTAAAAACTGCTTTTCTGAGTTAGGATAGGTCCCTTAGGATTAATG
TTTTGGTGAGTAGAAATACAGTATAACTTCTGCAAGTTGACCACCCAAAGACCTGTAACT
GGCCAACATAGGGAGGTGGTCAGCATAAGAACCTAAGCCTACTGTGCTGATGTGTACTTG
TGGTGCATGGCCAGTCTATGGAAACGAGGTCAATTTGGGGTGGTCAGTGTGCTTCCTATT
GAGGTTTTAGTGGATCAGTCATGGTATTTTCAGATCTTAATATTTCAGTATCTTCATATT
TTCATGAGGTGGCCCCATTCTTGTTTCTTGACATGTCTAGCAATTTTGGTTACTGATCTC
TGTACCTTCTTAGAGGTCAGTTTGCTCAGGAAAAATCAAAGCTGTGTGAAAGAGGAAGAC
CAAGTTACATTTAGAGCAGAAAAGGAAGTATGTAGTAAGGAATAAGAGGGATGAAGAGGA
ATTCTTCAGAAGGGTGTAATTAATAGAAACTCTTTTCACACATGATCTCTGTCACACACC
ATGAACCCACAATTCCCCCTGCTGCCCCCTCCCCTCCCCTTCGGTTCCCTTTCACAGGTG
GTAATCCTTTGTGAGTCTGTGCAGCGATGCATTGCCCTGGCCCAGCTCCTGTTGAGCAGA
ACTTTCCAGCCATCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTTTGGCCGAGGCATGGACATTG
AACGGGTGATCATTGCCTTTAACTATGACATGCCCGAGGATTCTGACACCTACCTCCATC
GGGTAAGCCCCACGTCCAAAAGAACATCCCATCCTTCCAGCCTTTTGTTTTCTCTCCTTA
TGTACCTTACGTCCTCCCTGCCTCTGGGTGTCTTTCCTCATCTGGGTCTTCTAGTCCTAC
TATTTGTTTCCTTCTAGGTGGCCCGAGCAGGCCGGTTTGGCACCAAGGGCTTGGCCATCA
CATTTGTGTCAGATGAGAATGATGCCAAGATCCTTAATGATGTGCAGGATCGTTTTGAAG
TCAATATTAGTGAGCTGCCCGATGAGATAGACATCTCCTCCTACAGTGAGTATTGATCTC
ATGAAGCCCTTTATTTATTTATTTTTTCCCCTCATCTCCCATTTCAAATTCTTTCACAGT
GAGAACCTTGGTTCCCCCCAAAATCAGTAAATTCTCATGAAGCCCTTTAAATCTATTTGT
TCCTCAGTGTGTTTCTCAAGAATCCCATCATGGGGCTCGGTGCCAGCCACATACACTCAA
GGTGGCAGGTTTGAGTCCAGCCCAGGCCCGCCAAAACAAAATGATGGCTGCAACCAAAAA
TAGCCGGGCATTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGA
CTCGCTTGAGCCCAGGAGTTCGAGGTTGCTGTGAACTGTGATGTCACAGCACTCTGCCCA
GGTGGATAGCTTGAGGCTCTGTCTCCAAAAAAAAAAAAAAAAAAGAATTCCATCACGGGT
AATGGCCTGATGTGTAATGAACCCTTGACCAGTTCATAGCCCACTGCCCCTCACCCCTTT
GATGCAGTGTTGGGATGTGTTCATGACGCCTTTGTGGAGTCTCATTCTTCTCTCATGTTA
TTTCAGCTTCCCTGTCACTAGTCTTTCCTGTGAATTCACACAACACGCCAACATCCATCT
GCATGTGTGGGAGTACATTCCTGCCGTGCCTTTTGTGTTCGTGTGCCTTATTCTGACGGT
GTCATGAGTTCTCCTCAGTCGAACAGACACGGCAGAGGATTTACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTCTCA
TGTTATTTCACTTTCCCTGTCACTAGTCTTTCCTGTGTAATTGCACACAACACGCCAACA
TCCATCTGCATGTGTGTGTGTACATTCCTGCCTTGCCTTTTGTGTTCCTGTGCCTTATTC
TGACGGTGTCATGATTTCTCCTCAGTTGAACAGACACGGTAGAGGATTTACCCATTCTGG
AATGCGACAGTCTGTTCTTCAGGAGAGGACACCAAGTGTGGGGGTGAAGGAGACACTACT
GCCACCTGCCCCTGACAGCCCCACCCTCACCCCATGGCGTCCCTCTTCTGCATCACCACC
ACTCCTAAACCCCCCATTTCCTGATTTATCAGAATTTTTTTTAACAAAACTGAAAATGAA
ACACATGTGTGTCTGTGGAATCTGTTGAGTGGTTTGTCCCTTTATTGTATTTGTGGTGAG
GTTATTTTAGGGCTGGTCCAGGGTGAATTTCTGTGAGGATTGTGTACTCTGCTATGGAAT
AAGGTCAGTGGGTGGGATCAGAGGGAGGGATGGGACTAAGGCTCCCCCACTGCCTGCTGG
TTTCTGCCCCTTCCTGGAAGTCTCTTCTAGTTTCTCAGTGGCCTTTGAGGGCCTGAGGTA
TTAACTGATTGCCGGGCTCCTGGGGGGTGGTGTGTAGCATTTCCAGTGTTGAAAGGTGAT
GTGGTGAGGGCTGGTGGGAAGCTTAGGCCTCTCCTCCGAGCTCCTTCGGTGTCTCCTCAT
CTGTTCTTTCAGCTTCTGGATCTTGAGTACCAAAAGCCTGTGCCTCCCAGGCCCCCTCCT
GCCCTTCCAGCAAGGCTGGTACAGCTCCAGCTCCTGCTCCAGCAACTCTCAGCTTGAGCC
AGCTCGGCTGTGCGGTGGGGCTGGGGACCCTGGATGAGGGGGAATTGGGAAGGAGCATTG
ACTATGGGAGGGGCTGAGGCTCCTGGGCCGCTGTGTTGCAGAGTTTGGCCAGGAGTCAGG
AATTCAACCCTCTCCCTTTTTCCACCCCATTAGTGTAAGGCCACCTGCACTAAGAAGCCT
CTGCTTGCTGCGTAGGACTCTAGGAGGCATATAGAGATCACTGGCCCAGGGGCTATAACT
GGATTCCTTGAACAAGGATTGGGGTCACTGGAAAGAGGACTGGCTGGCCCTACACCCTGA
GAAATAATTAACTGTTAGGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1336, 1709..1801, 7669..7852, 9233..9351, 11798..11929, 14668..14718, 14721..14776, 15444..15504, 15609..15692, 15828..15975, 17516..17532
1001..1336, 1709..1801, 7669..7852, 9233..9351, 11798..11929, 14668..14718, 14721..14776, 15444..15504, 15609..15692, 15828..15975, 17516..17529
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved